معلومة

رنين البلازمون السطحي (SPR) يتنبأ بحد الوزن الجزيئي؟

رنين البلازمون السطحي (SPR) يتنبأ بحد الوزن الجزيئي؟



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

بمجرد طرح السؤال ، هل يمكننا التنبؤ بكيفية تحليل الوزن الجزيئي المنخفض (LMW) الذي يمكن لنظام SPR الخاص بنا اكتشافه بناءً على LOD (حد الاكتشاف) وحساسيتنا عند اكتشاف بروتين آخر؟ لذلك في الوقت الحالي ، يمكن لنظامنا المطور اكتشاف ألفا سينوكلين (14 كيلو دالتون) مع LOD حوالي 5fg / ml. هل يمكننا التنبؤ بكيفية اكتشاف LMW؟ هل هناك أي ورقة مرجعية أو شيء من هذا القبيل. لأنه بقدر ما أعرف ، يمكننا الحصول على تغيير RII بناءً على التجارب أولاً. لكن حالتي الآن هي أنني أريد اختبار حد أجهزة SPR الخاصة بنا لاكتشاف LMW (أختار تحليلات LMW التي أشتريها الآن)

شكرا لك! نقدر جدا أي مناقشة أو تعليقات


مستشعرات رنين البلازمون السطحية في بيولوجيا الخلية: الأساسيات والتطبيق

أصبحت المستشعرات الضوئية القائمة على إثارة البلازمونات السطحية ، والتي يشار إليها باسم مستشعرات رنين البلازمون السطحي (SPR) ، أداة تحليلية مركزية لتوصيف وقياس مجموعة متنوعة من التفاعلات الجزيئية ، مثل ملامسات مستقبلات ليجند. إلى جانب هذا المجال الكلاسيكي للتطبيق ، في السنوات الخمس عشرة الماضية ، اكتسب تطوير مستشعرات SPR التي تهدف إلى اكتشاف وتحليل تفاعلات الترابط / الخلية أو المضيف / الممرض ، والاتصالات الخلوية / الخلوية ، والتفاعلات الخلوية زخمًا كبيرًا. يتزايد باطراد عدد المنشورات التي تبلغ عن تطبيقات أجهزة استشعار SPR التي تنفذ الخلايا بدائية النواة أو حقيقية النواة كعناصر إدراك بيولوجي للتشخيص الطبي أو المراقبة البيئية أو السلامة البيولوجية. تعطي هذه المراجعة مقدمة قصيرة لتقنية رنين الطحين السطحي والمعلمات المهمة لتطبيقها في مجال مستشعرات الخلايا الحيوية. علاوة على ذلك ، تم تلخيص المنشورات المتعلقة بتطبيق مثل هذه المستشعرات في تحليل التفاعلات الخلوية وردود الفعل الخلوية للمنبهات خارج وداخل الخلايا.

هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


الملخص

يصعب اكتشاف الجزيئات الصغيرة مباشرة باستخدام أجهزة رنين البلازمون السطحية المتاحة تجاريًا (SPR). وذلك لأن المركبات ذات الوزن الجزيئي المنخفض لا تحتوي على كتلة كافية لإحداث تغيير قابل للقياس في معامل الانكسار. ومع ذلك ، فإن معامل الانكسار حساس لخصائص أخرى إلى جانب كتلة الحليلة. تم الإبلاغ مؤخرًا عن اكتشاف تغييرات توافقية كبيرة للبروتينات المعطلة باستخدام SPR. ومع ذلك ، لم يتم استغلال هذه الخاصية حتى الآن للكشف عن ارتباط الترابط ذو الوزن الجزيئي المنخفض بمستقبلات البروتين المعطلة. نوضح هنا أنه يمكن استخدام التغييرات التوافقية التي يسببها ligand لمراقبة ارتباط الجزيئات الصغيرة ببروتين ربط المالتوز المعطل و transglutaminase الأنسجة. أدى ارتباط Ligand بمستقبل يتناقص في نصف القطر الهيدروديناميكي إلى انخفاض صافٍ في معامل الانكسار. لوحظ تغير إيجابي صاف في معامل الانكسار لمستقبل يزيد في نصف القطر الهيدروديناميكي. لا يمكن تفسير تغيرات معامل الانكسار بإضافة الكتلة الجزيئية التحليلية إلى السطح. كانت استجابات SPR هذه نتيجة لتفاعلات محددة لمستقبلات ligand ، كما تم الحكم عليها من خلال انعكاس الاستجابة وأوجه التشابه بين ثوابت تفكك التوازن التي يحددها SPR وثوابت الانفصال المبلغ عنها. بالإضافة إلى ذلك ، أثبتت هذه التقنية فعاليتها في اكتشاف روابط محددة من لوحة من الجزيئات الصغيرة. لا تتطلب طريقة SPR هذه أي تعديلات في الأجهزة المستخدمة على نطاق واسع والمتاحة تجاريًا ، ولكنها سمحت بالكشف المباشر عن الجزيئات الصغيرة جدًا مثل أيونات الكالسيوم (40 Da). إن استخدام تشكيل المستقبلات للكشف عن التحليلات ذات الوزن الجزيئي المنخفض له تطبيقات محتملة في الفحص عالي الإنتاجية لمكتبات الأدوية الجزيئية الصغيرة وتطوير أجهزة الاستشعار الحيوية.

العنوان الحالي: قسم الكيمياء الحيوية ، جامعة ويسكونسن ماديسون ، ماديسون ، WI 53706.

المؤلف المراسل: (بريد إلكتروني) [بريد إلكتروني & # 160 محمي] (فاكس) 919-597-6400.


الملخص

من الصعب اكتشاف الجزيئات الصغيرة مباشرة باستخدام أجهزة رنين البلازمون السطحية المتاحة تجاريًا (SPR). وذلك لأن المركبات ذات الوزن الجزيئي المنخفض لا تحتوي على كتلة كافية لإحداث تغيير قابل للقياس في معامل الانكسار. ومع ذلك ، فإن معامل الانكسار حساس لخصائص أخرى إلى جانب كتلة الحليلة. تم الإبلاغ مؤخرًا عن اكتشاف تغييرات توافقية كبيرة للبروتينات المعطلة باستخدام SPR. ومع ذلك ، لم يتم استغلال هذه الخاصية حتى الآن للكشف عن ارتباط الترابط ذو الوزن الجزيئي المنخفض بمستقبلات البروتين المعطلة. نوضح هنا أنه يمكن استخدام التغييرات التوافقية التي يسببها ligand لمراقبة ارتباط الجزيئات الصغيرة ببروتين ربط المالتوز المعطل و transglutaminase الأنسجة. أسفر ارتباط Ligand بمستقبل يتناقص في نصف القطر الهيدروديناميكي عن انخفاض صافٍ في معامل الانكسار. لوحظ تغير إيجابي صاف في معامل الانكسار لمستقبل يزيد في نصف القطر الهيدروديناميكي. لا يمكن تفسير تغيرات معامل الانكسار بإضافة الكتلة الجزيئية التحليلية إلى السطح. كانت استجابات SPR هذه نتيجة لتفاعلات محددة لمستقبلات ligand ، كما تم الحكم عليها من خلال انعكاس الاستجابة وأوجه التشابه بين ثوابت تفكك التوازن التي يحددها SPR وثوابت الانفصال المبلغ عنها. بالإضافة إلى ذلك ، أثبتت هذه التقنية فعاليتها في اكتشاف روابط محددة من لوحة من الجزيئات الصغيرة. لا تتطلب طريقة SPR هذه أي تعديلات في الأجهزة المستخدمة على نطاق واسع والمتاحة تجاريًا ، ولكنها سمحت بالكشف المباشر عن الجزيئات الصغيرة جدًا مثل أيونات الكالسيوم (40 Da). إن استخدام تشكيل المستقبلات للكشف عن التحليلات ذات الوزن الجزيئي المنخفض له تطبيقات محتملة في الفحص عالي الإنتاجية لمكتبات الأدوية الجزيئية الصغيرة وتطوير أجهزة الاستشعار الحيوية.

العنوان الحالي: قسم الكيمياء الحيوية ، جامعة ويسكونسن ماديسون ، ماديسون ، WI 53706.

المؤلف المراسل: (بريد إلكتروني) [بريد إلكتروني & # 160 محمي] (فاكس) 919-597-6400.


المواد والأساليب

جمع العينات وعزل الخلايا الليمفاوية

تم جمع الدم في قوارير حمض إيثيلين ديامينيتراسيتيك (EDTA) (Venoject K2E ، لوفين ، بلجيكا) من متبرع تم شفاؤه من التهاب اللثة بعد العلاج (مركز إعادة تأهيل الفم ، رعاية صحة الأسنان العامة ، مجلس مقاطعة أوسترجوتلاند ، لينكوبينج ، السويد). تم تخفيف الدم الكامل في محلول كلوريد الصوديوم بنسبة 0.9 ٪ بنسبة 1: 1 وتم وضعه في طبقات بعناية على 6.0 مل من محلول اللمفوبريب (Axis-shield PoC ، أوسلو ، النرويج) في أنبوبين من ficoll (Thermofischer Scientific Inc. ، ستوكهولم ، السويد) من أجل الطرد المركزي المتدرج عند 1800 ز عند 20 درجة مئوية لمدة 20 دقيقة. تم مسح طبقة واضحة مميزة من الخلايا الليمفاوية بعناية وغسلها بمحلول ملحي مخزّن بالفوسفات (PBS pH 7.2 Apoteket AB ، Linkoping ، السويد). الخلايا المزروعة في وسط l -15 تحتوي على l -glutamine (ATCC ، Boras ، السويد) ، مكملًا بنسبة 10 ٪ من مصل بقري جنيني (FBS Sigma-Aldrich ، ستوكهولم ، السويد) وحضنت عند 37 درجة مئوية بين عشية وضحاها.

وافقت اللجنة الأخلاقية الإقليمية في Linköping على الدراسة (2010 / 307-31) ، وتم إبلاغ جميع المرضى المشاركين في دراستنا بالموافقة.

الزراعة البكتيرية وتحفيز الخلايا الليمفاوية

البورفيروموناس اللثوية النوع البري ATCC 33277 (American Type Culture Collection ، Manassas ، VA) ، من النوع البري W 50 ، E8 (مشتق من W50 RgpA ناقص و RgpB ناقص) و K1A (W50 مشتق Kgp ناقص) (يرجى توفيره من قبل البروفيسور MA كورتيس ، مجموعة مسببات الأمراض الجزيئية ، كوين ماري ، جامعة لندن ، المملكة المتحدة) ، من النوع البري 381 ، DPG-3 (381 مشتق من Fim A) ، و KRX-178 (381 مشتق من Mfa-1 ناقص) (يرجى التزويد بواسطة البروفيسور RJ Genco ، قسم علم الأحياء الدقيقة والمناعة ، جامعة بوفالو ، نيويورك) في مرق لاهوائي سريع التحمل (29.7 جم / لتر ، درجة الحموضة 7.2) في ظل ظروف لاهوائية (80٪ N2، 10٪ كو2، و 10٪ ح2) عند 37 درجة مئوية في غرفة (Concept 400 Anaerobic Workstation Ruskinn Technology Ltd. ، ليدز ، المملكة المتحدة). تم غسل البكتيريا وإعادة تعليقها في محلول جلوكوز كريبس رينجر (120 ملي كلوريد الصوديوم ، 4.9 ملي كلوريد البوتاسيوم ، 1.2 ملي مولار MgSO4، 1.7 ملي KH2ص4، 8.3 ملي مولار Na2HPO4، و 10 ملي جلوكوز ، ودرجة الحموضة 7.3).

قتل الحرارة ص. اللثة عن طريق الحضانة عند 80 درجة مئوية لمدة 20 دقيقة. تم نشر ما مجموعه 10 ميكرولتر من المعلق المقتول بالحرارة على لوحة أجار لاهوائية شديدة الحساسية لضمان قتل البكتيريا واحتضانها عند 37 درجة مئوية لمدة 5 أيام. قتل الحرارة ص. اللثة تم استخدام ATCC 33277 ، 10 9 cfu / mL لتحفيز الخلايا الليمفاوية واحتضانها عند 37 درجة مئوية. تم استكمال الوسط الطازج على فترات منتظمة حتى 21 يومًا.

تحليل التدفق الخلوي للخلايا الليمفاوية

تم إجراء تحليل التدفق الخلوي لدراسة تكوين الخلية. تم طرد الخلايا عند 300 ز (Eppendorf Centrifuge 5702R5 ، Germany) لمدة 5 دقائق ، وتم إذابة الحبيبات في 1000 ميكرولتر من PBS عند التخلص من المادة الطافية. تم تحديد تكوين الخلية عن طريق خلط 100 ميكرولتر من العينة مع 20 ميكرولتر من كوكتيل الأجسام المضادة من CD19 و CD3 و CD16 / 56 و CD45 علامات السطح الموسومة بفلوروكروم ألوفيكوسيانين (APC) ، فلوريسئين أيزوثيوسيانات (FITC) ، فيكواريثرين (PE) ، و مركب بروتين الكلوروفيل بيريدينين (PerCP) (BD Biosciences ، ستوكهولم ، السويد) وحضنت لمدة 15 دقيقة في الظلام. تم تحلل خلايا الدم الحمراء عن طريق إضافة 450 ميكرولتر من محلول lysing (2 ٪ من مصل العجل الجنيني (FCS Sigma-Aldrich ، ستوكهولم ، السويد) ، 0.1 ٪ محلول أزيد الصوديوم في PBS pH 7.4). بعد 15 دقيقة من الحضانة ، تم تحليل الخلايا في BD FACS Canto (BD Biosciences ، ستوكهولم ، السويد). تم رسم النتائج على مقياس لوغاريتمي عن طريق بوابات الخلايا الليمفاوية CD45 + للتحليل. تم تحليل الخلايا بعد أسبوع واحد من التحفيز بالبكتيريا ، بينما تم تحليل الخلايا غير المحفزة بعد 3 أيام. لم تحتوي الخلايا الليمفاوية غير المحفزة بعد 3 أيام على عدد كافٍ من الخلايا لإجراء مزيد من التحليل بسبب عدم وجود عامل منشط. لذلك ، تم عزل الخلايا الليمفاوية واستزراعها من دم نفس المريض ، كما هو موضح سابقًا ، قبل ثلاثة أيام من تحليل التدفق الخلوي.

تلطيخ مناعي ومجهري متحد البؤر

تم تحفيز تعليق الخلية بواسطة أسبوعين و 3 أسابيع من الحضانة تم طرده عند 170 ز، وتم إذابة الحبيبات في 2 مل من وسط لتر -15 طازج يحتوي على 10٪ FBS. تم بعد ذلك طرد ما مجموعه 200 ميكرولتر من تعليق 5 × 10 5 خلايا / مل عند 600 دورة في الدقيقة لمدة 6 دقائق. تم استخدام بارافورمالدهيد (4٪) لتثبيت الخلايا لمدة ساعتين عند درجة حرارة الغرفة. تم غسل الخلايا الثابتة أربع مرات باستخدام PBS على فترات 5 دقائق من الحضانة ، وتم حظرها باستخدام 5 ٪ FBS لمدة ساعة واحدة عند درجة حرارة الغرفة ، ثم غسلها مرة أخرى باستخدام نفس البروتوكول. تم تحضين الخلايا بأجسام مضادة CD38 المضادة للإنسان (BD Biosciences ، ستوكهولم ، السويد مخففة 1: 100) طوال الليل عند 4 درجات مئوية. تم غسل الخلايا باستخدام PBS كما كان من قبل ثم تم تحضينها بأجسام مضادة للفأر مترافقة مع فلورسين أيزوثيوسيانات لمدة ساعتين في درجة حرارة الغرفة. تم غسل الخلايا أربع مرات باستخدام PBS ثم تمت مواجهتها بتخفيف 1: 200 من 4ʹ ، 6-دياميدينو-2-فينيل إندول (DAPI) (Sigma-Aldrich ، ستوكهولم ، السويد) لمدة 3 دقائق. بعد الغسيل أربع مرات ، تم تحليل الخلايا في مجهر متحد البؤر لالتقاط الليزر (LCM) زايس (قسم علم الأمراض ، جامعة لينشوبينغ ، السويد).

انتعاش الجسم المضاد

بعد 3 أسابيع ، تم نقل وسط المزرعة إلى أنابيب معقمة للطرد المركزي سعة 15 مل (Greiner Bio-One ، ألمانيا) وطردها عند 3500 ز لمدة 10 دقائق لتكوير الخلايا. تم ترشيح المادة الطافية باستخدام مرشحات معقمة 0.45 ميكرومتر (Thermofisher Scientific ، ستوكهولم ، السويد) وطردها باستخدام مرشحات قطع ميكروكون 100 KDa Amicon (Millipore ، Molsheim ، فرنسا) عند 3500 ز لمدة 60 دقيقة. المادة الطافية التي تحتوي على الأجسام المضادة ل ص. اللثة مع الوزن الجزيئي & gt100 KDa ، وتم ترشيح المعقم باستخدام مرشحات معقمة 0.2 ميكرومتر (Thermofisher Scientific ، ستوكهولم ، السويد) ليتم تخزينها عند -50 درجة مئوية.

رحلان هلام الصوديوم دوديسيل كبريتات بولي أكريلاميد

تم إجراء التحليل الكهربائي للهلام المعياري لكبريتات الصوديوم دوديسيل بولي أكريلاميد لتصور تفاعل المستضد مع الجسم المضاد كطريقة بديلة لإظهار خصوصية الأجسام المضادة لمولدات الضد. قتل الحرارة ص. اللثة، الذي تم استخدامه لتحفيز الخلايا الليمفاوية المضيفة ، تم تحضينه بكل من مضاداتص. اللثة إنتاج الأجسام المضادة في المختبر ومضاداتالإشريكية القولونية الأجسام المضادة (تشخيصات سويد ، ستوكهولم ، السويد).

تم تخفيف جميع العينات المحضرة بنسبة 1: 4 باستخدام PBS (الرقم الهيدروجيني 7.4 ، Sigma-Aldrich ، ستوكهولم ، السويد) وتم طردها بالطرد المركزي عند 3450 ز لمدة 10 دقائق بعد 24 ساعة من الحضانة. تم طرد المواد الطاردة المركزية في مرشحات طرد مركزي 100 KDa (Millipore ، ستوكهولم ، السويد) وتم تسخينها بحجم متساوٍ من عازلة Laemmli لمدة 5 دقائق. تم تشغيل العينات في هلام الصوديوم دوديسيل كبريتات بولي أكريلاميد الكهربائي TGX المواد الهلامية الجاهزة (Bio-rad ، ستوكهولم ، السويد).

مقايسة الفئة الفرعية IgG

تم إجراء تحليل الفئة الفرعية IgG على الأجسام المضادة المنتجة في المختبر باستخدام مجموعة ELISA. تم تحضير ألواح ELISA المطلية مسبقًا والكواشف وفقًا لتعليمات الشركة الصانعة. إنتاج الأجسام المضادة في المختبر ضد ص. اللثة تم تخفيفه باستخدام مخفف ELISA بنسبة 1: 4. تم استخدام محلول IgG المضاد للإنسان من البيروكسيديز كجسم مضاد ثانوي ، وتم استخدام محلول الركيزة 3،3ʹ ، 5،5ʹ- رباعي ميثيل بنزيدين لتفاعل الكروموجين. تمت قراءة النتائج عند 450 نانومتر في غضون ساعة بعد إضافة محلول الإيقاف في قارئ ELISA الصغير (قارئ ELISA الخبير 96 ، GmBH ، النمسا). تم استخدام مصل الإنسان المقدم من الشركة المصنعة كعنصر تحكم ، وتم حساب التركيزات من المعايير.

صدى سطح البلازمون

مضاد-ص. اللثة تم تجميد الأجسام المضادة على شريحة مستشعر CM 5 من Biacore® 1000 (GE Healthcare Ltd ، السويد) للتحقيق في تفاعلات معينة بين مستضد وجسم مضاد باستخدام طريقة اقتران الأمين. تم تنفيذ الشلل في ثلاث خطوات. أولاً ، تم تنشيط سطح القناة المغلف بالكاربوكسي ميثيل ديكستران على الرقاقة عن طريق حقن ن-هيدروكسيكسينيميد و نخليط - ميثيل نديميثيل أمينوبروبيل كربوناميد هيدروكلوريد (GE Healthcare Ltd ، السويد) (نسبة 1: 1). مضاد-ص. اللثة تم تخفيف الأجسام المضادة باستخدام الأسيتات (الرقم الهيدروجيني 4.5) ، والذي يرتبط بالسطح المنشط للرقاقة عند الحقن. أخيرًا ، تم إلغاء تنشيط سطح المستشعر عن طريق حقن 70 ميكرولتر من الإيثانولامين (GE Healthcare Ltd ، السويد) ، مما يمنع ارتباط الجسيمات الأخرى بسطح المستشعر.

تم اختبار الأجسام المضادة المجمدة عن طريق تشغيل الضوابط الإيجابية والسلبية. IgG المضاد للإنسان (Sigma-Aldrich ، St Louis ، MO) والمقتل بالحرارة ص. اللثة استخدمت لتحفيز الخلايا الليمفاوية في وقت سابق كعناصر تحكم إيجابية. تم استخدام العديد من السلالات البكتيرية ATCC (CCUG ، Gothenberg ، السويد) وخنازير غينيا المضادة IgG (Sigma-Aldrich) كعناصر تحكم سلبية. تم قياس الاستجابة التي تم الحصول عليها باستخدام SPR في RU باستخدام برنامج التقييم Bia (GE Healthcare Ltd. ، السويد).

الكشف عن البورفيروموناس اللثوية في المختبر وفي العينات السريرية

تم جمع عينات البلازما من المتبرعين بالدم الأصحاء واحتضانها مع 10 8 cfu / mL من المسوخات البرية والخماسية من ص. اللثة. تم تخفيف العينات بنسبة 1:20 في PBS 7.4 (Sigma-Aldrich ، ستوكهولم ، السويد) ، وحضنت مجموعة من هذه مع مضادات-ص. اللثة بين عشية وضحاها. تم تشغيل العينات ، مع أو بدون حضانة الجسم المضاد ، على رقاقة مثبتة بمضادص. اللثة الأجسام المضادة بمعدل تدفق 5 ميكرولتر / دقيقة.

تم جمع عينات السائل اللثوي (GCF) من المرضى (ن = 30) مع التهاب دواعم السن الشديد غير المعالج في قسم أمراض اللثة ، مركز إعادة التأهيل الفموي في لينشوبينغ ، السويد ، ومن مجموعة من الضوابط الصحية اللثوية المتطابقة مع العمر والجنس (ن = 30).

تم الحصول على العينات من أعمق جيب اللثة في كل ربع أو من الموقع الإنسي لجميع الضواحك الأولى في موضوعات التحكم بدون جيوب عميقة. تمت إزالة اللويحة فوق اللعابية دون تلوث اللعاب ، وتم السماح للأسنان بالتجفيف في الهواء. تم إدخال شرائط Periopaper على عمق حوالي 1-2 مم تحت اللثة لتجميع GCF ، وتم تحديد حجم GCF الذي تمتصه الشرائط باستخدام Periotron 8000 (Oraflow Inc ، NY) ، والذي تمت معايرته كما هو موضح سابقًا (Chapple et al.., 1999). تم تجميع GCF من أربعة شرائح حول الورق لكل مريض في المخزن المؤقت المخفف (Quantikine Human HGF immunoassay ، R&D Systems ، Minneapolis ، MN) وتم تجميده عند درجة حرارة -20 درجة مئوية حتى استخدامه.

تم إذابة العينات قبل الاستخدام وتم تخفيفها بنسبة 1:20 باستخدام PBS معقم (Sigma-Aldrich ، ستوكهولم ، السويد). تم تشغيل العينات على الرقاقة التي تم تجميدها بمضاداتص. اللثة الأجسام المضادة بمعدل تدفق 5 ميكرولتر / دقيقة.

تحليل تهجين رقعة فحص الدنا DNA

تم جمع العينات الميكروبية تحت اللثة من نفس المواقع الأربعة لأخذ عينات GCF. تمت إزالة اللويحة فوق اللثة ، وسمح لسطح الجذر ليجف في الهواء. تم جمع العينة البكتيرية عن طريق إدخال نقطة ورقية معقمة يتم إدخالها في الجيب اللثوي حيث تم استخدام عينات بكتيرية تحت اللثة من نفس المواقع الأربعة حيث تم جمع GCF لمدة 20 ثانية ، والتي تم نقلها بعد ذلك إلى أنبوب اختبار معقم. تمت معالجة العينات في قسم علم الأحياء الدقيقة والمناعة في الفم ، جامعة جوتنبرج ، السويد ، وتم تحليلها لوجودها ص. اللثة، باستخدام تقنية تهجين رقعة فحص الحمض النووي والحمض النووي مع حد اكتشاف لا يقل عن 10000 خلية (Socransky et al., 1994). تم تضمين العينات أيضًا في دراساتنا السابقة (Lonn et al., 2014 ).

تفاعل البلمرة المتسلسل في الوقت الحقيقي

تم إجراء تحليل PCR في الوقت الحقيقي للتحقق من صحة طريقة تحليل SPR للكشف عن ص. اللثة في عينات GCF. تم اختيار العينات التي أظهرت استجابات مختلفة في تحليل رقعة فحص الحمض النووي والحمض النووي وطرق SPR وتمت مقارنتها بالضوابط الصحية. ص. اللثة تم استخدام تسلسل التمهيدي الأمامي 16S rRNA لـ TGTAGATGACTGATGTGTAAAACC وتسلسل التمهيدي العكسي لـ ACGTCATCCCCACCTTCCTC. تم استخدام SYBR Green (Maxima® SYBR Green / ROX qPCR Master Mix ، Fermentas ، السويد) ، وتم ضبط شروط PCR على التمسخ الأولي عند 95 درجة مئوية لمدة 10 دقائق متبوعة بـ 95 درجة مئوية ، و 15 ثانية لمدة 40 دورة ، ثم 60 درجة مئوية ، 60 ثانية في 7900 HT في الوقت الحقيقي أداة PCR (النظم البيولوجية التطبيقية).

المجهر الإلكتروني للإرسال

تم إجراء الفحص المجهري الإلكتروني للإرسال لدراسة ألفة ربط المضادص. اللثة إلى ص. اللثة. ص. اللثة تم تحضين 1:20 المخفف في PBS بمضادات-ص. اللثة تم تخفيف الأجسام المضادة بنسبة 1: 100 في برنامج تلفزيوني. تم غسل الأجسام المضادة الزائدة باستخدام برنامج تلفزيوني ، وتمت إضافة IgG المضاد للإنسان المسمى بالذهب بنسبة 1: 1000 (مجسات نانو جولد ، نيويورك). تم تحضين الخليط عند 37 درجة مئوية لمدة ساعة واحدة. تم غسل الأجسام المضادة الزائدة باستخدام PBS وتثبيتها بـ 1 ٪ رابع أكسيد الأوزميوم (Sigma-Aldrich ، ستوكهولم ، السويد) حتى التركيب على شبكة نحاسية مغطاة بـ 200 ميكرومتر (Agar Scientific ، ستانستيد ، المملكة المتحدة). تم استخدام أسيتات اليورانيل (2٪ ، سيجما ألدريتش ، ستوكهولم ، السويد) للتلوين قبل الفحص في المجهر الإلكتروني النافذ JEOL 1230 (قسم علم الأمراض ، جامعة لينكوبينج ، السويد).

تحليل احصائي

تم إجراء تحليل مربع Chi لمقارنة النتائج التي تم الحصول عليها من طريقتين لتحليل SPR وتحليل رقعة فحص الحمض النووي والحمض النووي ، وتحليل SPR والنسخ العكسي- PCR (RT-PCR) باستخدام منشور لوحة الرسم البياني ، الإصدار 5.0 (GraphPad Software، Inc. ، كاليفورنيا، الولايات المتحدة الأمريكية). من جدول توزيع مربع تشي لدرجة الحرية 1 و ص & gt 0.05 رفضًا لفرضية العدم (Fisher RAaY، 1963) مع عدم وجود فروق ذات دلالة إحصائية بين النتائج التي تم الحصول عليها بالطريقتين الجاري تحليلهما.


رنين البلازمون السطحي (SPR) يتنبأ بحد الوزن الجزيئي؟ - مادة الاحياء

رنين البلازمون السطحي (SPR) هو ظاهرة يتم من خلالها صنع الفوتونات لمزاوجة الطاقة بموجة كثافة الإلكترون السطحية التي تنتقل على واجهة معدنية عازلة. يحدث الاقتران عند طاقة وزخم محددين ، يشار إليهما مجتمعين بحالة الرنين ، مما يؤدي إلى تراجع في الضوء المنعكس. تعتبر خصائص الانحدار وظيفة لخصائص المواد في الواجهة ، وبالتالي فإن مراقبة الانحدار توفر معلومات حول بيئة السطح المحلية. شهدت السنوات الأخيرة دفعًا في تقنية SPR نحو التصغير وزيادة الحساسية والإنتاجية العالية والنهج متعدد الوسائط. تركز هذه الأطروحة على طريقتين لتحسين أداء أجهزة الاستشعار الحيوية SPR. أولاً ، يتم تحسين حساسية SPR من خلال استخدام بنية سطحية ذات فجوة الحزمة من مأكل الطحالب. يتضح هنا أن تشغيل جهاز الاستشعار الحيوي SPR في وضع الاستجواب الزاوي بالقرب من حافة فجوة الحزمة سيؤدي إلى زيادة الحساسية بمقدار ستة أضعاف مقارنة بـ SPR على سطح معدني مسطح تحت نفس الظروف. ثانيًا ، يتم عرض طريقة لتحسين حد الاكتشاف باستخدام تقنية تحليل بيانات جديدة تعتمد على معالجة الصور. يتم استخدام تقنية استجواب مأكل الطحين متعدد الوسائط لإنشاء صورة ثنائية الأبعاد للتشتت الطيفي الزاوي من السطح والتي يتم استخدامها بعد ذلك لاستخراج المعلومات حول البيئة السطحية باستخدام تقنية تحليل eigenvector تم تطويرها لاستغلال المعلومات الطيفية الزاوية. يؤدي استخدام تقنية eigenvector الجديدة ، المعينة على أنها طريقة الإسقاط المزدوج (DPM) ، على البيانات الطيفية الزاوية إلى تقديرات معامل الانكسار على نطاق ديناميكي واسع مع حد كشف نظري يبلغ 5 × 10-9 وحدات معامل الانكسار (RIU) التي تعتبر متفوقة إلى أعلى الأساليب الحالية القائمة على الطور حساسية. يُظهر العمل التجريبي طريقة DPM القادرة على مراقبة التفاعلات الجزيئية الحيوية مع المواد المتفاعلة ذات الوزن الجزيئي الصغير (∼400 دالتون) في الوقت الفعلي بدقة محققة تبلغ 2x10-6 RIU.


الاستشعار بالرنين السطحي: من الجزيئات الحيوية المنقاة إلى الخلايا السليمة

أصبح رنين البلازمون السطحي (SPR) تقنية معروفة جيدًا خالية من الملصقات لقياس حركيات الربط بين الجزيئات الحيوية منذ اختراع أول جهاز استشعار مناعي قائم على SPR في الثمانينيات. الشكل الأكثر شيوعًا وتقليديًا لتحليل SPR هو مراقبة الإشارات الضوئية في الوقت الفعلي عندما يتدفق محلول يحتوي على جزيئات يجند عبر ركيزة مستشعر وظيفية بجزيئات مستقبلات نقية. في السنوات الأخيرة ، سمح التطور السريع لعدة أنواع من تقنيات تصوير SPR برسم خرائط التوزيع الديناميكي لكثافة الكتلة المحلية داخل الخلايا الحية الفردية بدقة مكانية وزمنية عالية وحساسية موثوقة. مكنت هذه القدرة المرء على الفور من التحقيق في التفاعل بين الجزيئات الحيوية المهمة والخلايا السليمة بطريقة خالية من الملصقات ، وكمية ، وخلية واحدة ، مما أدى إلى اتجاه جديد مثير للتحليل البيولوجي المستند إلى الخلية SPR. في مقالة الاتجاه هذه ، نصف أولاً المبدأ والميزات التقنية لنوعين من تقنيات التصوير SPR بناءً على المنشور والموضوع ، على التوالي. ثم نقوم بمسح التطبيقات السليمة القائمة على الخلايا في كل من بيولوجيا الخلية الأساسية واكتشاف الأدوية. نختتم المقال بتعليقات ووجهات نظر حول التطورات المستقبلية.

تسمح التطورات الأخيرة في تقنيات التصوير بالرنين السطحي (SPR) برسم خرائط خالية من الملصقات لتوزيع الكتلة داخل الخلايا الحية المفردة ، مما يؤدي إلى توسعات كبيرة في دراسات التفاعلات الجزيئية الحيوية من ركائز متجانسة وظيفية مع الجزيئات الحيوية المنقاة إلى ركائز غير متجانسة تحتوي على خلايا حية فردية


مستشعر التصوير بالرنين السطحي (SPRI) لتقدير السيستاتين بناءً على البابين المعطّل

تم تطوير مستشعر التصوير بالرنين السطحي (SPRI) لتحديد السيستاتين بشكل خاص. يحتوي المستشعر على غراء مثبت ، والذي يربط السيستاتين بالمحلول. تم تنشيط Papain مع N- Hydroxysuccinimide (NHS) و N-Ethyl-N- (3-dimethyl aminopropyl) carbodiimide (EDC) على سطح ذهبي معدل أمين. تم استخدام السيستامين لتعديل سطح الذهب. تم تحسين تركيز البابين ودرجة الحموضة للتفاعل. تم اختيار تركيز غراء من 1.5 ميكروغرام مل -1 ودرجة حموضة 6.5 على أنها الأمثل. تم التحقق من خصوصية التفاعل من خلال عدم وجود تفاعل مع الألبومين البشري. يتراوح نطاق الاستجابة الديناميكية لأجهزة الاستشعار بين 0 و 0.6 ميكروغرام مل -1 ، ويبلغ حد الكشف 0.09 ميكروغرام مل -1. تم التحقق من صحة النتائج من خلال المقارنة مع طريقة PETIA (مقايسة مناعية محسنة للجسيمات) التي أظهرت توافقًا جيدًا. تم استخدام منحنى معايرة لسيستاتين بياض بيض الدجاج أو سيستاتين سي. من أجل إظهار إمكانات المستشعرات ، تم تحديد السيستاتين C في بلازما الدم والبول واللعاب ، مما يدل على توافق جيد مع البيانات الواردة في الأدبيات. تم العثور على نتائج تركيز السيستاتين في بلازما الدم للأشخاص الذين يعانون من سرطان الدم أقل من المستوى الطبيعي للسيستاتين.

رسائل البروتين والببتيد

عنوان: مستشعر التصوير بالرنين السطحي (SPRI) لتقدير السيستاتين بناءً على البابين الثابت

الصوت: 18 مشكلة: 1

المؤلفون):E. Gorodkiewicz و J. Luszczyn

الانتماء:قسم الكيمياء الكهربائية ، معهد الكيمياء ، جامعة بياليستوك ، Al.J.Pilsudskiego11 / 4 ، 15-443 بياليستوك ، بولندا.

الملخص: تم تطوير مستشعر التصوير بالرنين السطحي (SPRI) لتحديد السيستاتين بشكل خاص. يحتوي المستشعر على غراء ثابت ، والذي يربط السيستاتين بالمحلول. تم تنشيط Papain مع N- Hydroxysuccinimide (NHS) و N-Ethyl-N- (3-dimethyl aminopropyl) carbodiimide (EDC) على سطح ذهبي معدل أمين. تم استخدام السيستامين لتعديل سطح الذهب. تم تحسين تركيز البابين ودرجة الحموضة للتفاعل. تم اختيار تركيز غراء من 1.5 ميكروغرام مل -1 ودرجة حموضة 6.5 على أنها الأمثل. تم التحقق من خصوصية التفاعل من خلال عدم وجود تفاعل مع الألبومين البشري. يتراوح نطاق الاستجابة الديناميكية لأجهزة الاستشعار بين 0 و 0.6 ميكروغرام مل -1 ، ويبلغ حد الكشف 0.09 ميكروغرام مل -1. تم التحقق من صحة النتائج من خلال المقارنة مع طريقة PETIA (مقايسة مناعية محسنة للجسيمات) التي أظهرت توافقًا جيدًا. تم استخدام منحنى معايرة لسيستاتين بياض بيض الدجاج أو سيستاتين سي. من أجل إظهار إمكانات المستشعرات ، تم تحديد السيستاتين C في بلازما الدم والبول واللعاب ، مما يدل على توافق جيد مع البيانات الواردة في الأدبيات. تم العثور على نتائج تركيز السيستاتين في بلازما الدم للأشخاص الذين يعانون من سرطان الدم أقل من المستوى الطبيعي للسيستاتين.


النتائج والمناقشات

تصوير SPRM لفيروس الأنفلونزا أ وجزيئات السيليكا النانوية.

الصورة 2أ يعرض صور SPRM لجسيمات السيليكا النانوية مختلفة الحجم وفيروس الأنفلونزا H1N1. نظرًا لأن صورة SPR حساسة للسطح ، فإن الجسيمات الموجودة على السطح أو القريبة جدًا منه هي فقط المرئية. يتراوح حجم جسيمات الأنفلونزا أ الفيروسية من 90 إلى 110 نانومتر ، وفقًا للأدبيات (4). كما أن جسيمات السيليكا النانوية أصغر من حد الانعراج للميكروسكوب وغير مرئية في صورة الإرسال. تظهر صور SPR لكل من الجسيمات النانوية الفيروسية والسيليكا على شكل نقاط مضيئة بنمط حيود مثير للاهتمام على شكل حرف V. يرجع هذا النمط إلى تشتت موجات الطحين السطحية بواسطة الجسيمات النانوية ، والتي ستتم مناقشتها بالتفصيل لاحقًا.

(أ) صور SPRM لفيروس أنفلونزا H1N1 وثلاث جسيمات متناهية الصغر من السيليكا مختلفة الحجم في المخزن المؤقت لبرنامج تلفزيوني. (أقحم) صور الجسيمات النانوية الناتجة عن المحاكاة العددية. (ب و ج) ملامح شدة SPR للجسيمات المحددة على طول اتجاهات X و Y (يشار إليها بخطوط متقطعة في أ، على التوالى. (أقحم) ملفات التعريف المقابلة من الصور المحاكاة.

الدقة المكاني.

الصورة 2 ب و ج يُظهر ملامح شدة الصورة للجسيمات النانوية الفيروسية والسيليكا المختارة ، على طول (Y) وعمودي على (X) اتجاه انتشار Plasmon السطحي ، على التوالي (مميزة بخطوط متقطعة في الشكل 2).أ). بغض النظر عن حجم الجسيمات ، تُظهر ملامح الاتجاه العمودية عرضًا كاملاً بنصف حد أقصى (FWHM) يبلغ حوالي 0.5 ميكرومتر ، وهذا يرجع إلى حد الانعراج البصري. يبلغ حد الانعراج النظري للمجهر باستخدام ليزر 632 نانومتر وهدف NA 1.65 0.23 ميكرومتر ، والفرق بين الرقمين يرجع إلى أن شعاع الليزر الساقط لا يغطي فتحة الهدف بالكامل في إعدادنا ، مما ينتج عنه حجم أصغر فتحة عددية فعالة (الشكل 1). يكشف ملف الشدة على طول اتجاه انتشار مأكل الطحين السطحي أن الشدة تتحلل بطول اضمحلال يبلغ حوالي 3 ميكرومتر. يقيس تسوس الشدة طول الانتشار المحدود لموجات الطحين السطحية (الشكل 2ج) ، والتي تعتمد على نوع المعدن والطول الموجي للضوء الساقط. على سبيل المثال ، في حالة استخدام ضوء 532 نانومتر ، يتم تقليل طول الانتشار إلى ما يقرب من 0.2 ميكرومتر للذهب في الماء ، بالقرب من حد الانعراج (16). غالبًا ما يتم ملاحظة التذبذبات في الشدة الناتجة عن أنماط التداخل في النظام البصري ، لكنها لا تتحرك مع ترجمة المجهر x أو y ويمكن فصلها بسهولة عن ميزات العينة الحقيقية.

رسم تخطيطي لإعداد تجربة SPRM (الرسم ليس على نطاق واسع). يمكن العثور على وصف تفصيلي للإعداد في المواد والأساليب.

نمط الحيود.

تساعدنا أنماط الحيود المرتبطة بالجسيمات الفردية في تحديد الجسيمات النانوية من ضوضاء الخلفية وأنماط التداخل. صور محاكاة عدديا SPRM للجسيمات النانوية (الشكل 2أ أقحم) تؤكد أن الأنماط ترجع إلى تشتت موجات الطحين السطحية الناجم عن الجسيمات النانوية. ملامح الخط المحسوبة (الشكل 2 ب و ج أقحم) تتطابق بشكل جيد مع الملامح المقاسة. علاوة على ذلك ، تزداد كثافة الذروة المحسوبة لنمط الانعراج مع زيادة حجم الجسيم ، والذي يتوافق أيضًا مع البيانات التجريبية.

التفاعلات الفيروسية السطحية.

من خلال تتبع صور الجسيمات بمرور الوقت ، يمكننا التمييز بين أنواع مختلفة من التفاعلات بين الفيروسات والسطح. حصلنا على صور SPRM لفيروس الأنفلونزا على ثلاثة أسطح مختلفة: الذهب العاري ، والسطح الوظيفي PEG ، والسطح الوظيفي المضاد للأنفلونزا. تين. 3أ يعرض تسلسل زمني لصور SPRM لجزيئات الأنفلونزا A على الذهب. يتوفر مقطع فيديو (فيلم S1) لهذا التسلسل. يمكن ملاحظة التصاق الجزيئات الفيروسية بسطح الذهب مباشرة بعد تصاعد المحلول الفيروسي في محلول المخزن المؤقت. في المقابل ، لا تلتصق جسيمات السيليكا النانوية بالسطح ، وتظهر وتختفي من الصورة بسبب الحركة البراونية (انظر الفيلم S2).

صور SPRM لفيروس الأنفلونزا أ على الذهب العاري. (أ) تسلسل صور SPRM لفيروس الأنفلونزا. تُظهر خريطة الألوان كثافة صورة SPR النسبية في mDeg. (ب) تتغير شدة SPR بمرور الوقت في المناطق (المشار إليها بالمستطيلات) حيث يمتص الجسيم الفيروسي الفردي على سطح الذهب.

تين. 3ب يوضح متوسط ​​الشدة لثلاثة جسيمات فيروسية تمثيلية (موضحة كمستطيلات خطية متقطعة في الشكل 3أ) بمرور الوقت على سطح ذهبي مكشوف. يشار إلى اللحظات التي تظهر فيها الجزيئات الفيروسية في صورة SPRM بالسهام. بمجرد أن يصطدم الجسيم الفيروسي بالسطح ، فإنه يظل على السطح ، مما يشير إلى امتزاز قوي وغير محدد للجزيئات الفيروسية على الذهب.

في المقابل ، يتصرف الفيروس بشكل مختلف تمامًا على الأسطح المطلية بالجسم المضاد والـ PEG. الشكل 4أ يُظهر ملامح شدة SPRM النموذجية بمرور الوقت لجزيئات الأنفلونزا A الفردية على السطحين. On the PEG-functionalized surface, the individual viral particles are imaged only as transient events—they appear and disappear rapidly, which is completely different from the behavior on the bare gold surface. This observation is expected because PEG coating is well known for its capability to block nonspecific binding of biomolecules to surfaces. The transient appearance and disappearance of the viral particles on the PEG-coated surface is due to Brownian motion. On the antibody-functionalized surface, the behavior of the viral particles is in between the two limits described above. We observed that individual viral particles tended to stay on the surface for much longer time than on the PEG-coated surface, but they eventually leave the surface. This observation can be attributed to a reversible binding of the viral particles to the antibody-coated surface.

(أ) SPR intensity vs. time profiles for influenza A viral particles on PEG and antiinfluenza A antibody-functionalized surfaces. (ب) Histogram showing relative binding probabilities of influenza A on PEG and antiinfluenza A antibody-functionalized surfaces. The analysis of control experiment, HCMV on antiinfluenza A antibody-functionalized surfaces, is also shown for comparison. Note the vertical axis of the histogram is the probability of a particle stays on the surface (determined from the time profiles similar to أ).

By tracking the individual viral particles in the SPRM image over time, we obtain the probabilities of individual influenza particles staying on the PEG and antiinfluenza-coated surfaces (Fig. 4ب). For comparison, the statistical analysis of human cytomegalovirus (HCMV) on the antiinfluenza antibody-coated surface is also plotted in Fig. 4ب. The histogram clearly shows that the specific binding of influenza A on the antibody-coated surface is significantly higher than the nonspecific bindings in the two control experiments, influenza A on the control PEG surface and the control virus, HCMV, on the antibody surface.

The single virus detection with our SPRM was carried out in a static solution, but the findings are consistent with those obtained with the conventional flow-through SPR measurement using samples with the same concentrations (Fig. S1). For example, the injection of 0.1 ml of 0.05 mg/ml influenza A solutions at a flow rate of 30 μl/ min resulted in a large irreversible binding of the virus on the bare gold chip, which is due to strong nonspecific interactions between influenza A and gold surface. On a PEG-functionalized chip, no virus binding was detected by the flow-through SPR. On an antibody-coated chip, approximately 45 mDeg SPR angular shift was observed, which is in between the two extremes. Finally, the flow-through SPR detected no significant binding of HCMV (0.25 mg/ml) onto the antiinfluenza A-coated chip.

Quantitative Analysis of Influenza A Size and Mass.

Mass is a fundamental physical parameter of substances, and precise measurement of mass is one of the most important analytical methods, such as mass spectroscopy (17). A widely used method to measure virus mass is based on ultracentrifugation, which determines the averaged mass of virus in a sample from density gradient sedimentation (18, 19). SPR measures the optical mass of each viral particle, which is directly related to the inertia mass of the particle. To determine the mass of influenza virus, we used silica nanoparticles with a refractive index of 1.46 as calibration standard. The refractive index of influenza based on its protein and lipid contents is approximately 1.48, close to that of the silica nanoparticles. Dry influenza consists of 70 to 75% proteins and 20 to 24% lipids (20), and the mass density of hydrated influenza virus is 1.19 g/ml (20, 21). At such a mass density, the refractive index of a protein solution is 1.48 (22), and the refractive index of lipids is similar (23). Based on these considerations, the refractive index of influenza virus was taken to be 1.48.

We measured the intensities of the individual nanoparticles from the SPRM images and constructed histograms for silica nanoparticles and influenza viral particles (Fig. 5أ). The histograms of the silica nanoparticles can be approximately fit with Gaussian distributions, but a small peak appears at an intensity twice of the main peak in each histogram (arrows in Fig. 5أ). We attributed it to the formation of nanoparticle dimers. الشكل 5ب plots the relative SPRM intensity at the peak of each histogram vs. silica nanoparticle volume determined from the size and density provided by the manufacturers for each particle sample (Table S1). The intensity of a nanoparticle is expected to be proportional to the volume of the particle exposed in the evanescent field associated with the propagating surface plamsons. By considering that the evanescent field decays exponentially with distance from the surface, we express the intensity with [1] where ك is a constant (fitting parameter), ض is distance above the gold surface, ص is radius of the particle, and ل is the decay constant of the evanescent field, which is approximately 200 nm. Eq. 1 provides a good fit to the experimental data shown in Fig. 5ب (solid line).

(أ) Histograms of relative SPR intensity distributions of individual silica nanoparticles and influenza A viral particles. The solid red lines are Gaussian fittings of the distributions. Arrows indicate peaks that are likely due to the formation of dimmers. (ب) Calibration curve of SPR intensity plotted vs. particle volumes. The average volume of an influenza particle is obtained from the calibration curve and the average SPR intensity in the histogram plotted in A. The vertical error bars are standard deviations of the Gaussian fittings of the histograms of the SPR intensities. The horizontal error bars for the silica nanoparticles are standard deviations calculated from the coefficient of variation of particle diameter given by the manufacturers, and the horizontal error bars for the influenza are estimated from the standard deviation of the volume extracted from the SPR intensity.

From the calibration curve shown in Fig. 5ب and the histogram in Fig. 5أ, the volume and diameter of influenza A were found to be 6.8 ± 3.0 × 10 -4 μm 3 and 109 ± 13 nm, respectively. Given that the mass density of influenza A is 1.19 g/ml (19), the mass of influenza A virus was determined to be 0.80 ± 0.35 fg, which is in good agreement with the literature values (4, 20, 21) (see الملحق SI for details).

Using the same method, we also obtained the histogram of SPRM image intensity for HCMV viral particles (Fig. S2). Using the calibration curve in Fig. 5ب, we find that the average volume and diameter of a HCMV viron are 5.4 ± 0.7 × 10 -3 μm 3 and 218 ± 10 nm (assuming the refractive index of HCMV is 1.48), respectively, which are in consistent with the literature (approximately 230 nm diameter) (24). Using a reported density of 1.219 g/ml (25), we calculated that the mass of each HCMV viron is 6.5 ± 0.8 fg.

Detection Limit.

Fig. S3 shows the noise level of current setup. The noise level for an area covering a single particle image (∼3 × 5 μm) is 0.3 mDeg. Most SPR detections have time resolution of about one second. Using a one-second moving average, we can reduce the noise to 0.04 mDeg. This noise level, according to the calibration curve in Fig. 5, can detect 13 nm nanoparticles, corresponding to a detectable mass of approximately 1 × 10 -18 g (1 ag).

A more useful way to define the detection limit is detectable mass per unit sensing area, because it is directly related to the detectable analyte concentration in solution, an important quantity for most applications. This detection limit definition also allows one to compare sensors with different sensing areas. For instance, a small sensor may have a lower total mass detection limit, but its small sensing area makes it less likely to detect the analyte molecules. For our current SPRM setup, the entire image area is the sensing area, which is 0.08 × 0.06 mm 2 , so the binding of a single particle with mass as small as 1 ag on the sensing area can be detected. In terms of mass per unit area, the achieved detection limit is 0.2 fg/mm 2 , which is nearly four orders of magnitude better than the typical detection limit of the conventional SPR (15). This improved detection limit is provided by our capability of imaging single viral particles, which allows us to average signals in the regions of viral particles only so that noises in all other regions do not affect the signals of the particles. We note that further improvement in the detection limit may be achieved by using less noisy light source and CCD and by reducing mechanical vibrations of the system.


Biophysics uses biophysical instrumentation to characterize macromolecules in solution and study molecular interactions. The platform uses mass spectrometry for protein identification and small molecule identification and quantification and performs quality control of recombinant proteins for optimized data quality in downstream applications.

The platform ensures proper instrument function with routine maintenance and checks for high standards of performance.

As an active member of the ARBRE-MOBIEU EU network, a cluster of biophysics facilities across Europe, the platform contributes to improving information exchange, development and evaluation of new technologies.

  • State of the art instrumentation UV-VIS spectrophotometer: Protein/nucleic acid quantification. Enzyme kinetics.
  • Circular Dichroism (CD): Information about secondary structure and protein stability.
  • Fluorescence Spectroscopy (FS): Binding studies.
  • Differential Scanning Fluorimetry (DSF): Thermal stability of globular proteins. Protein quality controls (optimal buffers for downstream applications, storage conditions).
  • Dynamic Light Scattering (DLS): Sizes and distributions of biomolecules in solution.
  • Size Exclusion Chromatography coupled to Multi-Angle Light Scattering (SEC-MALS): Absolute molar mass determination.
  • MicroScale Thermophoresis (MST): Measurement of binding interactions.
  • Isothermal Titration Calorimetry (ITC): Thermodynamic technique to study different binding events.
  • Surface Plasmon Resonance (SPR): Measurement of biomolecular interactions in real time.Provides kinetic information (kتشغيل و كإيقاف rates). Screening of low molecular weight analytes.
  • Mass spectrometer (ESI-TOF MS).: Protein identification. Small molecule identification and quantification.


شاهد الفيديو: D-Shaped Optical Fiber Surface Plasmon Resonance. COMSOL SIMULATIONS (أغسطس 2022).