معلومة

مصطلحات النسخ (omics): cDNAs ، ESTs ، RNA-seq ، إلخ

مصطلحات النسخ (omics): cDNAs ، ESTs ، RNA-seq ، إلخ


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لقد عملت بشكل متكرر مع بيانات الجينوم والنسخة لعدة سنوات حتى الآن ، لكنني ما زلت غير متأكد بنسبة 100٪ من أنني أفهم الاستخدام الصحيح لبعض المصطلحات المتعلقة بالنصوص والنسخ. اسمحوا لي أن أقدم أفضل ما لدي.

  • كدنا: بشكل عام ، يتوافق هذا المصطلح مع أي DNA مشتق من قالب RNA عبر النسخ العكسي (الحمض النووي التكميلي) ؛ ومع ذلك ، غالبًا ما يتم استخدامه للإشارة إلى (كدنا) كامل الطول، تسلسلات الحمض النووي التي تتوافق مع جزيئات الرنا المرسال الكاملة
  • est: أعرب عن علامات التسلسل تتوافق مع تسلسلات (كدنا) التي تم الحصول عليها من قراءة واحدة لتجربة تسلسل (كدنا)
  • تسلسل الحمض النووي الريبي: يشير هذا إلى استخدام تقنيات التسلسل عالية الإنتاجية لتوصيف النسخ الكاملة ، مثل تجميع النسخ أو تحليل التعبير

إليكم ما يثير قلقي: لقد رأيت ESTs موصوفة على أنها متواليات "طلقة واحدة" أو "تمريرة واحدة" ، والتي أفسرها على أنها تعني قراءة تسلسل واحد. ومع ذلك ، يتم وصفها أيضًا على أنها مئات الأزواج الأساسية في الطول (تدعي ويكيبيديا حوالي 500-800 نقطة أساس في الطول كحد أقصى) ، والتي (حاليًا) تقصر هذا التعريف على القراءات المشتقة من تسلسل نمط سانجر.

هل هذا يعني أن قراءة قصيرة مشتقة من منصة تسلسل عالية الإنتاجية هي ليس عش؟ هل هذا التمييز على أساس طول القراءة؟ برنامج؟ الإنتاجية؟

نظرًا للقيود الفنية ، غالبًا ما يتم تجميع القراءات القصيرة قبل استخدامها في التحليل النهائي الآخر. لقد سمعت أحيانًا أن contigs تنتمي إلى هذه التجمعات مثل EST ، ولكن لا يبدو أن هذا يتفق مع التعريفات السابقة.

هل أصبحت مصطلحاتنا غير متسقة بسبب التحسينات السريعة في تقنية التسلسل ، أم أنني مفقود أو أسيء تفسير شيء ما؟


الإجابة السريعة هي أنك تسيء تفسير EST. EST تعني علامة التسلسل المعبر عنها. يتم الحصول عليها عن طريق جمع وتسلسل أي ناضجة (أي poly-A) mRNAs الموجودة في الخلية الحية. حسنًا ، كان يعيش حتى تم إجراء التجربة بأي معدل :).

لا ينطبق مصطلح EST على التسلسلات المشتقة من البيانات الجينية. إنه ينطبق فقط على أعربت التسلسلات. لديك بالفعل ESTs مشتقة من مكتبات (كدنا) ولكن يتم التعبير عن هذه cDNAs. لا تُعد القراءات القصيرة عبارة عن نماذج EST لأننا لا نملك معلومات حول ما إذا كان يتم التعبير عن هذا التسلسل بالفعل في خلية حية.

يمكنك تطبيق المصطلح على قراءات RNAseq (اعتمادًا على الإجراء التجريبي المتضمن) ولكن هذا ليس ما يفهمه معظم الناس من خلال المصطلح.

باختصار ، يتم "التعبير" عن المصطلح العملي لـ EST. لا يمكنك استدعاء أي شيء بـ EST إذا لم يكن لديك دليل على أنه يتم التعبير عنه بنشاط في خلية حية.


2 سنتي:

للإجابة على سؤالك الرئيسي:

هل أصبحت مصطلحاتنا غير متسقة بسبب التحسينات السريعة في تقنية التسلسل ، أم أنني مفقود أو أسيء تفسير شيء ما؟

أعتقد أن ما تشهده (خاضعًا لـ (؟)) هو ، كما تقول ، تضاربًا في المصطلحات بسبب التحسينات السريعة في هذا المجال.

أضع التحذير في أنك تتعرض لهذا لأنني أشك في أن الأشخاص الذين يشيرون إلى "الأشياء" التي يولدها بروتوكول تسلسل الجيل الثاني مثل "EST" يستخدمون كلمة مألوفة لوصف شيء قد يكون غير مألوف لهم .

هل هذا يعني أن القراءة القصيرة المشتقة من منصة تسلسل عالية الإنتاجية ليست EST؟ هل هذا التمييز على أساس طول القراءة؟ برنامج؟ الإنتاجية؟

أعتقد أنه (ط) بناء ؛ (2) المنصة ؛ (3) الإنتاجية ؛ و (4) "الكمية النسبية".

نظرًا للقيود الفنية ، غالبًا ما يتم تجميع القراءات القصيرة قبل استخدامها في التحليل النهائي الآخر.

لقد فقدتني هنا بكلمة "غالبًا" - هل تتحدث عن RNAseq الآن أم أن هذا هو EST. إذا كان لديك جينوم مرجعي ، أعتقد أن تجميع قراءات RNAseq قبل تحليل المصب (المحاذاة (؟)) هو استثناء بدلاً من القاعدة ... وهذا هو سبب ضياعي.


يوفر التسلسل متعدد omics نظرة ثاقبة في انتقال الأزهار في كاتالبا بونجي. أ. مي

يلعب انتقال الأزهار دورًا مهمًا في التنمية ، والوقت المناسب ضروري لتحسين قيمة أشجار الزينة القيمة. تظل الآليات الجزيئية لانتقال الأزهار غير معروفة في النباتات الخشبية المعمرة. "Bairihua" هو نوع من C. bungei التي يمكن أن تخضع لانتقال الأزهار في السنة الأولى للزراعة.

نتائج

هنا ، قمنا بدمج تسلسل الجيل التالي قصير القراءة (NGS) وتسلسل الوقت الحقيقي لجزيء واحد (SMRT) لتوفير رؤية أكثر اكتمالاً لتنظيم النسخ أثناء الانتقال الأزهار في C. bungei. قد يكون مسار الإيقاع اليومي للنبات هو المسار الحرج أثناء انتقال الأزهار في الإزهار المبكر (EF) C. bungeiوفقا للتحليل الأفقي والرأسي في EF والزهور الطبيعي (NF) C. bungei. يبدو أن SBP و MIKC-MADS-box كانا متورطين في EF أثناء انتقال الأزهار. ارتبط ما مجموعه 61 جينًا محوريًا بانتقال الأزهار في نموذج MEturquoise مع تحليل شبكة التعبير المشترك للجينات الموزونة (WGCNA). كشفت النتائج أن عشرة جينات محورية لها علاقة وثيقة بـ الجين المتماثل GASA (Cbu.gene.18280) ، والجينات العشرة المعبر عنها بشكل مشترك تنتمي إلى خمسة مسارات ذات صلة بالازهار. علاوة على ذلك ، توفر دراستنا رؤى جديدة حول تعقيد وتنظيم الربط البديل (AS). تختلف نسبة أو عدد الأشكال الإسوية لبعض الجينات المرتبطة بانتقال الأزهار في فترات مختلفة أو في جينومات فرعية مختلفة.

الاستنتاجات

ستكون نتائجنا مرجعًا مفيدًا لدراسة انتقال الأزهار في النباتات الخشبية المعمرة الأخرى. هناك حاجة إلى مزيد من التحقيقات الجزيئية للتحقق من بيانات التسلسل لدينا.


محتويات

تتكون الخلية البشرية النموذجية من حوالي 2 × 3.3 مليار زوج أساسي من الحمض النووي و 600 مليون قاعدة من الرنا المرسال. عادةً ما يتم استخدام مزيج من ملايين الخلايا في تسلسل الحمض النووي أو الحمض النووي الريبي باستخدام الطرق التقليدية مثل تسلسل سانجر أو تسلسل إلومينا. باستخدام التسلسل العميق للحمض النووي والحمض النووي الريبي من خلية واحدة ، يمكن التحقيق على نطاق واسع في الوظائف الخلوية. [1] مثل تجارب NGS النموذجية ، تحتوي بروتوكولات تسلسل الخلية المفردة عمومًا على الخطوات التالية: عزل خلية مفردة ، واستخراج الحمض النووي وتضخيمه ، وإعداد مكتبة التسلسل ، والتسلسل ، وتحليل البيانات الحيوية. يعتبر إجراء تسلسل خلية واحدة أكثر صعوبة مقارنة بالتسلسل من الخلايا بكميات كبيرة. يؤدي الحد الأدنى من كمية مواد البدء من خلية واحدة إلى حدوث تدهور وفقدان العينة والتلوث تأثيرات واضحة على جودة بيانات التسلسل. بالإضافة إلى ذلك ، نظرًا لمستوى البيكوجرام لكمية الأحماض النووية المستخدمة ، [4] غالبًا ما يكون التضخيم الثقيل مطلوبًا أثناء تحضير العينة لتسلسل الخلية المفردة ، مما يؤدي إلى التغطية غير المتكافئة والضوضاء والتقدير الكمي غير الدقيق لبيانات التسلسل.

جعلت التحسينات التقنية الحديثة تسلسل الخلية الواحدة أداة واعدة للتعامل مع مجموعة من المشاكل التي تبدو غير قابلة للوصول. على سبيل المثال ، يمكن توضيح العينات غير المتجانسة ، وأنواع الخلايا النادرة ، وعلاقات النسب الخلوية ، وفسيفساء الأنسجة الجسدية ، وتحليلات الميكروبات التي لا يمكن استزراعها ، وتطور المرض من خلال تسلسل خلية واحدة. [5] تم اختيار تسلسل الخلية الواحدة كأسلوب عام 2013 من قبل مجموعة Nature Publishing. [6]

يتضمن تسلسل جينوم الحمض النووي أحادي الخلية عزل خلية واحدة ، وتضخيم الجينوم بأكمله أو المنطقة محل الاهتمام ، وإنشاء مكتبات التسلسل ، ثم تطبيق تسلسل الجيل التالي من الحمض النووي (مثل Illumina ، Ion Torrent ، MGI). في أنظمة الثدييات ، تم تطبيق تسلسل الحمض النووي أحادي الخلية على نطاق واسع لدراسة علم وظائف الأعضاء والمرض الطبيعي. يمكن أن يكشف تحليل الخلية المفردة عن أدوار الفسيفساء الجينية أو التغايرية الجينية داخل الورم في تطور السرطان أو الاستجابة للعلاج. [7] في سياق الميكروبيوم ، يُشار إلى الجينوم المأخوذ من كائن وحيد الخلية على أنه جينوم واحد مضخم (SAG). مكنت التطورات في تسلسل الحمض النووي أحادي الخلية من جمع البيانات الجينومية من الأنواع بدائية النواة غير المزروعة الموجودة في الميكروبيومات المعقدة. [8] على الرغم من أن SAGs تتميز بانخفاض الاكتمال والتحيز الكبير ، إلا أن التطورات الحسابية الحديثة قد حققت تجميع الجينومات شبه الكاملة من SAGs المركبة. [9] البيانات التي تم الحصول عليها من الكائنات الحية الدقيقة قد تؤسس عمليات للزراعة في المستقبل. [10] تتضمن بعض أدوات تجميع الجينوم التي يمكن استخدامها في تسلسل جينوم الخلية الواحدة: SPAdes و IDBA-UD و Cortex و HyDA. [11]

طرق تحرير

يعد تضخيم الإزاحة المتعددة (MDA) تقنية مستخدمة على نطاق واسع ، مما يتيح تضخيم الفيمتوجرام من الحمض النووي من البكتيريا إلى ميكروغرام لاستخدام التسلسل. الكواشف المطلوبة لتفاعلات MDA تشمل: البادئات العشوائية وبوليميراز الحمض النووي من البكتيريا phi29. في تفاعل متساوي الحرارة بمقدار 30 درجة ، يتم تضخيم الحمض النووي باستخدام الكواشف المضمنة. عندما تصنع البوليميرات خيوطًا جديدة ، يحدث تفاعل إزاحة حبلا ، وتوليف نسخ متعددة من كل قالب DNA. في الوقت نفسه ، سيتم تهجير الخيوط التي تم تمديدها مسبقًا. تنتج منتجات MDA طولًا يبلغ حوالي 12 كيلو بايت ونطاقات تصل إلى حوالي 100 كيلو بايت ، مما يتيح استخدامها في تسلسل الحمض النووي. [10] في عام 2017 ، تم إدخال تحسين كبير على هذه التقنية ، يسمى WGA-X ، من خلال الاستفادة من متحور phi29 polymerase القابل للحرارة ، مما يؤدي إلى تحسين استعادة الجينوم من الخلايا الفردية ، ولا سيما تلك التي تحتوي على نسبة عالية من G + C . [13] تم تنفيذ MDA أيضًا في نظام قائم على قطرات موائع جزيئية لتحقيق تضخيم كامل للجينوم أحادي الخلية متوازي للغاية. من خلال تغليف الخلايا المفردة في قطرات لالتقاط الحمض النووي وتضخيمه ، توفر هذه الطريقة انحيازًا منخفضًا وإنتاجية محسّنة مقارنةً بـ MDA التقليدي. [14]

طريقة أخرى شائعة هي MALBAC. [15] تبدأ هذه الطريقة بتضخيم متساوي الحرارة كما هو الحال في MDA ، لكن البادئات محاطة بتسلسل "مشترك" لتضخيم PCR المصب. عندما يتم إنشاء الأمبليكونات الأولية ، فإن التسلسل المشترك يعزز الارتباط الذاتي وتشكيل "حلقات" لمنع المزيد من التضخيم. على عكس MDA ، لم يتم تشكيل شبكة DNA شديدة التشعب. بدلاً من ذلك ، في دورة درجة حرارة أخرى ، يتم تغيير طبيعة الحلقات ، مما يسمح بتضخيم الأجزاء باستخدام تفاعل البوليميراز المتسلسل. تم تنفيذ MALBAC أيضًا في جهاز ميكروفلويديك ، ولكن لم يتم تحسين أداء التضخيم بشكل كبير عن طريق التغليف في قطرات نانوليتر. [16]

بمقارنة MDA و MALBAC ، ينتج عن MDA تغطية أفضل للجينوم ، لكن MALBAC يوفر تغطية أكثر تساويًا عبر الجينوم. يمكن أن يكون MDA أكثر فاعلية لتحديد SNPs ، في حين يفضل MALBAC للكشف عن متغيرات رقم النسخ. أثناء إجراء MDA بجهاز ميكروفلويديك يقلل بشكل ملحوظ التحيز والتلوث ، لا تُظهر الكيمياء المشاركة في MALBAC نفس الإمكانات لتحسين الكفاءة.

طريقة مناسبة بشكل خاص لاكتشاف التباين الهيكلي الجيني هي تسلسل حبلا قالب الحمض النووي أحادي الخلية (المعروف أيضًا باسم ستراند- seq). [17] باستخدام مبدأ المعالجة ثلاثية القنوات أحادية الخلية ، والتي تستخدم النمذجة المشتركة لاتجاه القراءة ، وعمق القراءة ، وطور النمط الفرداني ، فإن Strand-seq يتيح اكتشاف الطيف الكامل لفئات التباين الهيكلي الجسدي ≥200kb في بحجم. يتغلب Strand-seq على القيود المفروضة على الأساليب القائمة على تضخيم الجينوم الكامل لتحديد فئات التباين الجيني الجسدي في الخلايا المفردة ، [18] لأنه غير حساس ضد أجهزة chimers التي تؤدي إلى استدعاؤها المصنوعات اليدوية (تمت مناقشتها بالتفصيل في القسم أدناه) ، وهي أقل المتأثرين بالتسرب. يعتمد اختيار الطريقة على الهدف من التسلسل لأن كل طريقة تقدم مزايا مختلفة. [7]

تحرير القيود

ينتج MDA لجينومات الخلايا الفردية في تغطية الجينوم غير المتكافئ للغاية ، أي التمثيل الزائد النسبي والتمثيل الناقص لمناطق مختلفة من القالب ، مما يؤدي إلى فقدان بعض التسلسلات. هناك مكونان لهذه العملية: أ) العشوائية المفرطة والتضخيم الناقص للمناطق العشوائية و ب) التحيز المنهجي ضد مناطق GC المرتفعة٪. يمكن معالجة المكون العشوائي عن طريق تجميع تفاعلات MDA أحادية الخلية من نفس نوع الخلية ، من خلال استخدام التهجين الفلوري في الموقع (FISH) و / أو تأكيد ما بعد التسلسل. [10] يمكن معالجة تحيز MDA ضد مناطق GC المرتفعة باستخدام البوليميرات المقاومة للحرارة ، كما هو الحال في عملية تسمى WGA-X. [13]

تشكل تعدد الأشكال أحادي النوكليوتيدات (SNPs) ، والتي تعد جزءًا كبيرًا من التباين الجيني في الجينوم البشري ، وتغير رقم النسخ (CNV) ، مشكلات في تسلسل الخلية المفردة ، فضلاً عن الكمية المحدودة من الحمض النووي المستخرج من خلية واحدة. بسبب الكميات الضئيلة من الحمض النووي ، فإن التحليل الدقيق للحمض النووي يطرح مشاكل حتى بعد التضخيم لأن التغطية منخفضة وعرضة للأخطاء. مع MDA ، يكون متوسط ​​تغطية الجينوم أقل من 80٪ وسيتم استبعاد تعدد الأشكال التي لا تغطيها قراءات التسلسل. بالإضافة إلى ذلك ، يُظهر MDA نسبة عالية من تسرب الأليل ، ولا يكتشف الأليلات من عينات متغايرة الزيجوت. العديد من خوارزميات SNP قيد الاستخدام حاليًا ولكن لا توجد خوارزميات خاصة بتسلسل الخلية المفردة. يطرح MDA مع CNV أيضًا مشكلة تحديد CNVs الخاطئة التي تخفي CNVs الحقيقية. لحل هذه المشكلة ، عندما يمكن إنشاء أنماط من CNVs الخاطئة ، يمكن للخوارزميات اكتشاف هذه الضوضاء والقضاء عليها لإنتاج متغيرات حقيقية. [19]

يتغلب Strand-seq على قيود الأساليب القائمة على تضخيم الجينوم الكامل لاستدعاء المتغير الجيني: نظرًا لأن Strand-seq لا يتطلب قراءة (أو قراءة أزواج) تعبر الحدود (أو نقاط التوقف) لـ CNVs أو فئات المتغيرات الهيكلية المتوازنة ، فهي أقل عرضة للقطع الأثرية الشائعة لأساليب الخلية المفردة القائمة على تضخيم الجينوم الكامل ، والتي تشمل المتسربين من الاتصال المتغير بسبب فقدان القراءات عند نقطة التوقف المتغيرة وقراءة الوهم. [7] [18] يكتشف ستراند- seq الطيف الكامل لفئات التباين الهيكلي التي لا يقل حجمها عن 200 كيلو بايت ، بما في ذلك دورات جسر الانصهار والاندماج وأحداث تشريب الصبغ ، بالإضافة إلى الانقلابات المتوازنة وعدد النسخ المتوازنة أو غير المتوازنة. [18] "الاستدعاءات المتغيرة الهيكلية التي يتم إجراؤها بواسطة Strand-seq يتم حلها عن طريق النمط الفرداني بطول الكروموسوم ، والذي يوفر خصوصية استدعاء متغيرة إضافية. ) ، ولا تكتشف الطريقة المتغيرات التي يقل حجمها عن 200 كيلوبايت ، مثل إدخالات عنصر الجوال.

تحرير التطبيقات

تعد الميكروبيوم من بين الأهداف الرئيسية لعلم جينوم الخلية الواحدة نظرًا لصعوبة زراعة غالبية الكائنات الحية الدقيقة في معظم البيئات. علم الجينوم أحادي الخلية هو وسيلة قوية للحصول على تسلسل الجينوم الميكروبي دون زراعة. تم تطبيق هذا النهج على نطاق واسع على الأنواع البحرية والتربة وتحت السطحية والكائنات الحية وأنواع أخرى من الميكروبيوم من أجل معالجة مجموعة واسعة من الأسئلة المتعلقة بالإيكولوجيا الميكروبية والتطور والصحة العامة وإمكانيات التكنولوجيا الحيوية. [20] [21] [22] [23] [24] [25] [26] [27] [28]

تسلسل السرطان هو أيضًا تطبيق ناشئ لـ scDNAseq. يمكن تحليل الأورام الجديدة أو المجمدة وتصنيفها فيما يتعلق بـ SCNAs و SNVs وإعادة الترتيب جيدًا باستخدام نهج الجينوم الكامل DNAS. [29] السرطان scDNAseq مفيد بشكل خاص لفحص عمق التعقيد والطفرات المركبة الموجودة في الأهداف العلاجية المضخمة مثل جينات مستقبلات التيروزين كيناز (EGFR ، PDGFRA وما إلى ذلك) حيث لا تستطيع المقاربات التقليدية على مستوى السكان للورم الأكبر حلها أنماط التواجد المشترك لهذه الطفرات داخل الخلايا المفردة للورم. قد يوفر هذا التداخل تكرارًا لتفعيل المسار ومقاومة الخلايا السرطانية.

يحدد تسلسل ميثيلوم الحمض النووي أحادي الخلية كمية مثيلة الحمض النووي. هناك عدة أنواع معروفة من الميثيل التي تحدث في الطبيعة ، بما في ذلك 5-ميثيل سيتوزين (5mC) ، 5-hydroymethylcytosine (5hmC) ، 6-methyladenine (6mA) ، و 4mC4-methylcytosine (4mC). في حقيقيات النوى ، وخاصة الحيوانات ، ينتشر 5mC على طول الجينوم ويلعب دورًا مهمًا في تنظيم التعبير الجيني عن طريق قمع العناصر القابلة للتحويل. [31] يمكن أن يكشف التسلسل 5mC في الخلايا الفردية كيف أن التغيرات اللاجينية عبر الخلايا المتطابقة جينيًا من نسيج واحد أو مجموعة سكانية تؤدي إلى ظهور خلايا ذات أنماط ظاهرية مختلفة.

طرق تحرير

أصبح تسلسل بيسلفيت المعيار الذهبي في اكتشاف وتسلسل 5mC في الخلايا المفردة. [32] معالجة الحمض النووي مع بيسلفيت يحول بقايا السيتوزين إلى اليوراسيل ، لكنه يترك 5-ميثيل سيتوزين غير متأثر. لذلك ، فإن الحمض النووي الذي تم معالجته باستخدام بيسلفيت يحتفظ فقط بالسيتوزينات الميثيلية. للحصول على قراءات الميثيلوم ، يتم محاذاة التسلسل المعالج بالبيسلفيت مع جينوم غير معدل. تم تحقيق تسلسل الجينوم الكامل بيسلفيت في خلايا مفردة في عام 2014. [33] تتغلب الطريقة على فقدان الحمض النووي المرتبط بالإجراء النموذجي ، حيث تتم إضافة محولات التسلسل قبل تجزئة بيسلفيت. بدلاً من ذلك ، تتم إضافة المحولات بعد معالجة الحمض النووي وتجزئته باستخدام بيسلفيت ، مما يسمح بتضخيم جميع الأجزاء بواسطة تفاعل البوليميراز المتسلسل. [34] باستخدام التسلسل العميق ، تلتقط هذه الطريقة

40٪ من إجمالي CpGs في كل خلية. مع التكنولوجيا الحالية لا يمكن تضخيم الحمض النووي قبل معالجة بيسلفيت ، حيث لن يتم نسخ علامات 5mC بواسطة البوليميراز.

يعد تسلسل ثنائي كبريتيت التمثيل ذو الخلية الواحدة (scRRBS) طريقة أخرى. [35] تزيد هذه الطريقة من ميل السيتوزينات الميثيلية إلى التجمع في جزر CpG (CGIs) لإثراء مناطق الجينوم ذات المحتوى العالي من CpG. هذا يقلل من تكلفة التسلسل مقارنة بتسلسل الجينوم الكامل بيسلفيت ، لكنه يحد من تغطية هذه الطريقة. عندما يتم تطبيق RRBS على عينات مجمعة ، يتم اكتشاف غالبية مواقع CpG في محفزات الجينات ، لكن الموقع في مروجي الجينات يمثل فقط 10 ٪ من مواقع CpG في الجينوم بأكمله. [36] في الخلايا المفردة ، يتم الكشف عن 40٪ من مواقع CpG من العينة السائبة. لزيادة التغطية ، يمكن أيضًا تطبيق هذه الطريقة على مجموعة صغيرة من الخلايا المفردة. في عينة من 20 خلية مفردة مجمعة ، تم اكتشاف 63 ٪ من مواقع CpG من العينة السائبة. يعد تجميع الخلايا المفردة إحدى الاستراتيجيات لزيادة تغطية الميثيلوم ، ولكن على حساب التعتيم على عدم التجانس في مجتمع الخلايا.

تحرير القيود

بينما يظل تسلسل بيسلفيت هو النهج الأكثر استخدامًا للكشف عن 5mC ، فإن المعالجة الكيميائية قاسية وتشظي وتؤدي إلى تدهور الحمض النووي. يتفاقم هذا التأثير عند الانتقال من العينات السائبة إلى الخلايا المفردة. تشمل الطرق الأخرى للكشف عن مثيلة الحمض النووي إنزيمات التقييد الحساسة للميثيل.تتيح إنزيمات التقييد أيضًا اكتشاف أنواع أخرى من المثيلة ، مثل 6mA مع DpnI. [37] يوفر التسلسل المستند إلى المسام النانوية أيضًا طريقًا لتسلسل المثيلة المباشر بدون تجزئة أو تعديل للحمض النووي الأصلي. تم استخدام تسلسل Nanopore لتسلسل ميثيلوم البكتيريا ، التي يهيمن عليها 6mA و 4mC (على عكس 5mC في حقيقيات النوى) ، ولكن لم يتم تقليص هذه التقنية بعد إلى خلايا مفردة. [38]

تحرير التطبيقات

تم استخدام تسلسل مثيلة الحمض النووي أحادي الخلية على نطاق واسع لاستكشاف الاختلافات اللاجينية في الخلايا المتشابهة وراثيًا. للتحقق من صحة هذه الأساليب أثناء تطويرها ، تم تصنيف بيانات methylome أحادية الخلية لمجموعة سكانية مختلطة بنجاح عن طريق المجموعات الهرمية لتحديد أنواع الخلايا المتميزة. [35] تطبيق آخر يدرس الخلايا المفردة خلال الانقسامات الخلوية القليلة الأولى في التطور المبكر لفهم كيفية ظهور أنواع مختلفة من الخلايا من جنين واحد. [39] تم أيضًا استخدام تسلسل الجينوم الكامل لبي سلفيت أحادي الخلية لدراسة أنواع الخلايا النادرة ولكن عالية النشاط في السرطان مثل الخلايا السرطانية المنتشرة (CTCs). [40]

يحدد تسلسل الكروماتين الذي يمكن الوصول إليه عبر خلية واحدة يمكن الوصول إلى الكروماتين عبر الجينوم. يقوم ال transposase بإدخال محولات التسلسل مباشرة في المناطق المفتوحة من الكروماتين ، مما يسمح بتضخيم هذه المناطق وتسلسلها. [41]

تحلل الطرق القياسية مثل المصفوفات الدقيقة وتحليل تسلسل الحمض النووي الريبي السائبة التعبير عن الحمض النووي الريبي من مجموعات كبيرة من الخلايا. في مجموعات الخلايا المختلطة ، قد تحجب هذه القياسات الاختلافات الحرجة بين الخلايا الفردية داخل هذه المجموعات السكانية. [42] [43]

يوفر تسلسل الحمض النووي الريبي أحادي الخلية (scRNA-seq) ملامح تعبير للخلايا الفردية ويعتبر المعيار الذهبي لتحديد حالات الخلايا والأنماط الظاهرية اعتبارًا من عام 2020. [44] على الرغم من أنه من غير الممكن الحصول على معلومات كاملة عن كل RNA معبر عنها بواسطة يمكن تحديد أنماط التعبير الجيني من خلال تحليلات التجميع الجيني لكل خلية ، نظرًا للكمية الصغيرة من المواد المتاحة. [٤٥] يمكن أن يكشف هذا عن وجود أنواع نادرة من الخلايا داخل مجموعة خلايا ربما لم يسبق رؤيتها من قبل. على سبيل المثال ، تم تحديد خلايا متخصصة نادرة في الرئة تسمى الخلايا الشاردة الرئوية التي تعبر عن منظم توصيل الغشاء عبر التليف الكيسي في عام 2018 من قبل مجموعتين تقومان بإجراء scRNA-Seq على ظهارة مجرى الهواء الرئوي. [46] [47]

طرق تحرير

تتضمن بروتوكولات scRNA-seq الحالية عزل الخلايا المفردة و RNA الخاصة بها ، ثم اتباع نفس الخطوات مثل RNA-seq بالجملة: النسخ العكسي (RT) ، والتضخيم ، وإنشاء المكتبة والتسلسل. فصلت الطرق المبكرة الخلايا الفردية إلى آبار منفصلة ، وهناك طرق أكثر حداثة تغلف الخلايا الفردية في قطرات في جهاز ميكروفلويديك ، حيث يحدث تفاعل النسخ العكسي ، وتحويل الحمض النووي الريبي إلى الحمض النووي الريبي. وتحمل كل قطرة "باركود" DNA الذي يسمي بشكل فريد cDNAs المشتقة من خلية واحدة. بمجرد اكتمال النسخ العكسي ، يمكن خلط cDNAs من العديد من الخلايا معًا لتسلسل النصوص من خلية معينة بواسطة الرمز الشريطي الفريد. [48] ​​[49]

تشمل التحديات التي تواجه scRNA-Seq الحفاظ على الوفرة النسبية الأولية لـ mRNA في الخلية وتحديد النصوص النادرة. [50] تعتبر خطوة النسخ العكسي أمرًا بالغ الأهمية حيث تحدد كفاءة تفاعل RT مقدار تعداد الحمض النووي الريبي للخلية الذي سيتم تحليله في النهاية بواسطة جهاز التسلسل. قد تؤثر عملية النسخ العكسية والاستراتيجيات الأولية المستخدمة على إنتاج cDNA كامل الطول وتوليد مكتبات منحازة نحو 3 'أو 5' نهاية الجينات.

في خطوة التضخيم ، يتم استخدام PCR أو النسخ في المختبر (IVT) حاليًا لتضخيم (كدنا). تتمثل إحدى مزايا الطرق القائمة على تفاعل البوليميراز المتسلسل (PCR) في القدرة على توليد (كدنا) كامل الطول. ومع ذلك ، قد يتم أيضًا تضخيم كفاءة PCR المختلفة على تسلسلات معينة (على سبيل المثال ، محتوى GC وهيكل snapback) بشكل كبير ، مما ينتج عنه مكتبات ذات تغطية غير متساوية. من ناحية أخرى ، في حين أن المكتبات التي تم إنشاؤها بواسطة IVT يمكن أن تتجنب تحيز التسلسل الناجم عن PCR ، فقد يتم نسخ تسلسلات محددة بشكل غير فعال ، مما يتسبب في تسرب التسلسل أو إنشاء تسلسلات غير كاملة. [1] [42] تم نشر العديد من بروتوكولات scRNA-seq: Tang et al.، [51] STRT، [52] SMART-seq، [53] CEL-seq، [54] RAGE-seq، [55] Quartz -seq. [56] و C1-CAGE. [57] تختلف هذه البروتوكولات من حيث استراتيجيات النسخ العكسي ، وتوليف cDNA والتضخيم ، وإمكانية استيعاب الرموز الشريطية الخاصة بالتسلسل (أي UMIs) أو القدرة على معالجة العينات المجمعة. [58]

في عام 2017 ، تم تقديم طريقتين لقياس مرنا أحادية الخلية وتعبير البروتين في وقت واحد من خلال الأجسام المضادة التي تحمل علامات قليلة النوكليوتيد والمعروفة باسم REAP-seq ، [59] و CITE-seq. [60]

تحرير القيود

تعتمد معظم طرق RNA-Seq على التقاط ذيل بولي (A) لإثراء mRNA واستنفاد الرنا الريباسي الوفير وغير المفيد. وبالتالي ، فإنها غالبًا ما تقتصر على تسلسل جزيئات الرنا المرسال متعدد الأدينيلات. ومع ذلك ، بدأت الدراسات الحديثة الآن في تقدير أهمية الحمض النووي الريبي غير متعدد (A) ، مثل الحمض النووي الريبي طويل الأمد غير المشفر و microRNAs في تنظيم التعبير الجيني. Small-seq هي طريقة أحادية الخلية تلتقط RNAs صغيرة (& lt300 نيوكليوتيدات) مثل microRNAs ، وشظايا من الحمض النووي الريبي tRNAs و RNAs نووية صغيرة في خلايا الثدييات. [61] تستخدم هذه الطريقة مزيجًا من "أقنعة قليلة النوكليوتيد" (التي تمنع التقاط جزيئات الرنا الريباسي 5.8S بكثرة جدًا) واختيار الحجم لاستبعاد أنواع كبيرة من الرنا مثل جزيئات الرنا الريباسي الأخرى الوفرة للغاية. لاستهداف رنا أكبر غير بولي (A) ، مثل مرنا طويل غير مشفر ، هيستون مرنا ، رنا دائري ، و RNA محسن ، لا ينطبق اختيار الحجم على استنفاد جزيئات الحمض النووي الريبوزي الوفير للغاية (18S و 28 s rRNA). [62] RamDA-Seq أحادية الخلية هي طريقة تحقق ذلك عن طريق إجراء نسخ عكسي مع تمهيد عشوائي (تضخيم إزاحة عشوائي) في وجود بادئات "غير عشوائية جدًا" (NSR) مصممة خصيصًا لتجنب التحضير لجزيء الرنا الريباسي. [63] بينما نجحت هذه الطريقة في التقاط نسخ كاملة الطول من الحمض النووي الريبي للتسلسل واكتشاف مجموعة متنوعة من الحمض النووي الريبي غير متعدد (A) ذات الحساسية العالية ، إلا أن لها بعض القيود. تم تصميم بادئات NSR بعناية وفقًا لتسلسل الرنا الريباسي في الكائن الحي المحدد (الفأر) ، وسيتطلب تصميم مجموعات أولية جديدة للأنواع الأخرى جهدًا كبيرًا. في الآونة الأخيرة ، أظهرت طريقة قائمة على CRISPR تسمى scDASH (استنفاد خلية واحدة للتسلسلات الوفيرة عن طريق التهجين) طريقة أخرى لاستنفاد تسلسلات الرنا الريباسي من مكتبات تسلسل الحمض النووي الريبي الكلية أحادية الخلية. [64]

البكتيريا وبدائيات النوى الأخرى غير قابلة حاليًا للخلية المفردة RNA-seq بسبب عدم وجود مرنا متعدد الأدينيلات. وبالتالي ، فإن تطوير أساليب تسلسل الحمض النووي الريبي أحادية الخلية التي لا تعتمد على التقاط ذيل بولي (A) سيكون مفيدًا أيضًا في تمكين دراسات الميكروبيوم ذات الدقة أحادية الخلية. تطبق الدراسات البكتيرية الضخمة عادةً استنفاد الرنا الريباسي العام للتغلب على نقص الرنا المرسال متعدد الأدينيلات على البكتيريا ، ولكن على مستوى الخلية المفردة ، يكون إجمالي الحمض النووي الريبي الموجود في خلية واحدة صغيرًا جدًا. [62] يعد نقص الرنا المرسال متعدد الأدينيلات وندرة إجمالي الحمض النووي الريبي الموجود في الخلايا البكتيرية المفردة عائقين مهمين يحدان من انتشار تسلسل سكرنا في البكتيريا.

تحرير التطبيقات

أصبح scRNA-Seq مستخدمًا على نطاق واسع عبر التخصصات البيولوجية بما في ذلك علم الأحياء التطوري ، [65] علم الأعصاب ، [66] علم الأورام ، [67] [68] [69] علم المناعة ، [70] [71] أبحاث القلب والأوعية الدموية [72] والأمراض المعدية. [73] [74]

باستخدام طرق التعلم الآلي ، تم استخدام البيانات من RNA-Seq السائبة لزيادة نسبة الإشارة / الضوضاء في scRNA-Seq. على وجه التحديد ، استخدم العلماء ملفات تعريف التعبير الجيني من مجموعات بيانات عموم السرطان من أجل بناء شبكات تعايش ، ثم قاموا بتطبيقها على ملفات تعريف التعبير الجيني للخلية المفردة ، والحصول على طريقة أكثر قوة لاكتشاف وجود الطفرات في الخلايا الفردية باستخدام مستويات النسخ. [75]

تم أيضًا تطبيق بعض طرق scRNA-seq على الكائنات الحية الدقيقة ذات الخلية الواحدة. تم استخدام SMART-seq2 لتحليل الميكروبات حقيقية النواة أحادية الخلية ، ولكن نظرًا لأنه يعتمد على التقاط ذيل بولي (A) ، لم يتم تطبيقه في الخلايا بدائية النواة. [76] تم استخدام أساليب ميكروفلويديك مثل Drop-seq و Fluidigm IFC-C1 لتسلسل طفيليات الملاريا المفردة أو خلايا الخميرة المفردة. [77] [78] سعت دراسة الخميرة أحادية الخلية إلى توصيف تحمل الإجهاد غير المتجانس في خلايا الخميرة المتجانسة قبل وبعد تعرض الخميرة لإجهاد الملح. كشف تحليل الخلية الواحدة للعديد من عوامل النسخ بواسطة scRNA-seq عن عدم التجانس عبر السكان. تشير هذه النتائج إلى أن التنظيم يختلف بين أفراد المجتمع لزيادة فرص البقاء على قيد الحياة لجزء صغير من السكان.

تم إنجاز أول تحليل للنسخة أحادية الخلية في الأنواع بدائية النواة باستخدام إنزيم نوكلياز خارجي المنهي لتحطيم الرنا الريباسي الانتقائي وتضخيم الدائرة المتدحرجة (RCA) من الرنا المرسال. [79] في هذه الطريقة ، تم ربط أطراف الحمض النووي المفرد الذي تقطعت به السبل معًا لتشكيل دائرة ، ثم تم استخدام الحلقة الناتجة كقالب لتضخيم الحمض النووي الريبي الخطي. ثم تم تحليل مكتبة المنتجات النهائية بواسطة ميكروأري ، مع انحياز منخفض وتغطية جيدة. ومع ذلك ، لم يتم اختبار RCA باستخدام RNA-seq ، والذي يستخدم عادةً تسلسل الجيل التالي. إن تسلسل الحمض النووي الريبي أحادي الخلية للبكتيريا سيكون مفيدًا للغاية في دراسة الميكروبيومات. سيعالج المشكلات التي تمت مواجهتها في مناهج النسخ الوصفية السائبة التقليدية ، مثل الفشل في التقاط الأنواع الموجودة في وفرة منخفضة ، والفشل في حل التباين بين مجموعات الخلايا.

قدم سكرنا- Seq نظرة ثاقبة في تطور الأجنة والكائنات الحية ، بما في ذلك الدودة Caenorhabditis elegans ، [80] والمستوي المتجدد Schmidtea mediterranea [81] [82] و axolotl Ambystoma mexicanum. [83] [84] كانت الحيوانات الفقارية الأولى التي تم رسم خرائط لها بهذه الطريقة هي الزرد [85] [86] [87] و Xenopus laevis. [88] في كل حالة تمت دراسة مراحل متعددة للجنين ، مما أتاح تخطيط عملية التطور بأكملها على أساس كل خلية على حدة. اعترف العلم بهذه التطورات على أنها اختراقة العام 2018. [89]

عزل الخلايا المفردة تحرير

هناك عدة طرق لعزل الخلايا الفردية قبل تضخيم الجينوم الكامل وتسلسله. يعتبر فرز الخلايا المنشطة الفلورية (FACS) نهجًا مستخدمًا على نطاق واسع. يمكن أيضًا جمع الخلايا الفردية عن طريق المعالجة الدقيقة ، على سبيل المثال عن طريق التخفيف المتسلسل أو باستخدام ماصة التصحيح أو الأنابيب النانوية لحصاد خلية واحدة. [15] [90] تتمثل مزايا المعالجة الدقيقة في السهولة والتكلفة المنخفضة ، ولكنها شاقة وعرضة للتعرّف الخاطئ على أنواع الخلايا تحت المجهر. يمكن أيضًا استخدام التشريح الدقيق لالتقاط الليزر (LCM) لتجميع الخلايا المفردة. على الرغم من أن LCM يحافظ على معرفة الموقع المكاني لخلية مأخوذة داخل نسيج ، فمن الصعب التقاط خلية واحدة كاملة دون جمع المواد من الخلايا المجاورة أيضًا. [42] [91] [92] تشتمل الطرق عالية الإنتاجية لعزل خلية واحدة أيضًا على موائع دقيقة. كل من نظام مراقبة الأصول الميدانية والموائع الدقيقة دقيقان وآليان وقادران على عزل العينات غير المتحيزة. ومع ذلك ، تتطلب كلتا الطريقتين فصل الخلايا عن بيئاتها الدقيقة أولاً ، مما يتسبب في حدوث اضطراب في ملفات تعريف النسخ في تحليل تعبير الحمض النووي الريبي. [93] [94]

عدد الخلايا المراد تحليلها تحرير

تحرير تسلسل سكرنا

بشكل عام ، بالنسبة لتجربة تسلسل الحمض النووي الريبي للخلايا السائبة النموذجية (RNA-seq) ، يتم إنشاء عشرة ملايين قراءة ويتم التعبير عن جين أعلى من عتبة 50 قراءة لكل كيلو بايت لكل مليون قراءة (RPKM). بالنسبة للجين الذي يبلغ طوله 1 كيلو بايت ، فإن هذا يتوافق مع 500 قراءة والحد الأدنى لمعامل التباين (CV) بنسبة 4 ٪ وفقًا لافتراض توزيع بواسون. بالنسبة لخلية الثدييات النموذجية التي تحتوي على 200000 mRNA ، يجب تجميع بيانات التسلسل من 50 خلية مفردة على الأقل من أجل تحقيق قيمة السيرة الذاتية الدنيا هذه. ومع ذلك ، نظرًا لكفاءة النسخ العكسي والضوضاء الأخرى التي تم إدخالها في التجارب ، هناك حاجة إلى مزيد من الخلايا لتحليلات التعبير الدقيقة وتحديد نوع الخلية. [42]


محتويات

تميز علم النسخ من خلال تطوير تقنيات جديدة أعادت تعريف ما هو ممكن كل عقد أو نحو ذلك وجعلت التقنيات السابقة عفا عليها الزمن. نُشرت المحاولة الأولى لالتقاط نسخة جزئية من نسخة بشرية في عام 1991 وأبلغت عن 609 تسلسل من الرنا المرسال من الدماغ البشري. [2] في عام 2008 ، تم نشر نسختين بشريتين ، مؤلفة من ملايين التسلسلات المشتقة من النسخ والتي تغطي 16000 جين ، [3] [4] وبحلول عام 2015 تم نشر النسخ لمئات الأفراد. [5] [6] يتم الآن بشكل روتيني إنشاء نسخ من حالات المرض المختلفة ، أو الأنسجة ، أو حتى الخلايا المفردة. [6] [7] [8] هذا الانفجار في النسخ كان مدفوعًا بالتطور السريع للتكنولوجيات الجديدة ذات الحساسية المحسنة والاقتصاد. [9] [10] [11] [12]

قبل تحرير النصوص

تم إجراء دراسات على النصوص الفردية قبل عدة عقود من توفر أي مقاربات نسخ. تم جمع مكتبات نصوص silkmoth mRNA وتحويلها إلى DNA تكميلي (cDNA) للتخزين باستخدام النسخ العكسي في أواخر السبعينيات. [13] في الثمانينيات ، تم استخدام التسلسل منخفض الإنتاجية باستخدام طريقة سانجر لتسلسل النصوص العشوائية ، وإنتاج علامات تسلسل معبر عنها (ESTs). [2] [14] [15] [16] كانت طريقة سانجر للتسلسل هي السائدة حتى ظهور طرق عالية الإنتاجية مثل التسلسل بالتوليف (Solexa / Illumina). برزت ESTs خلال التسعينيات كطريقة فعالة لتحديد المحتوى الجيني للكائن الحي دون تسلسل الجينوم بأكمله. [16] تم قياس كمية النصوص الفردية باستخدام النشاف الشمالي ، مصفوفات غشاء النايلون ، وطرق النسخ العكسي الكمي PCR (RT-qPCR) لاحقًا ، [17] [18] ولكن هذه الطرق شاقة ويمكن أن تلتقط فقط قسمًا فرعيًا صغيرًا من نسخة. [12] وبالتالي ، فإن الطريقة التي يتم بها التعبير عن نسخة كاملة وتنظيمها ظلت غير معروفة حتى تم تطوير تقنيات إنتاجية أعلى.

المحاولات المبكرة للتحرير

تم استخدام كلمة "ترانسكريبتوم" لأول مرة في التسعينيات. [19] [20] في عام 1995 ، تم تطوير واحدة من أقدم طرق النسخ القائمة على التسلسل ، وهي التحليل التسلسلي للتعبير الجيني (SAGE) ، والذي تم من خلال تسلسل سانجر لشظايا النسخ العشوائية المتسلسلة. [21] تم تحديد النصوص من خلال مطابقة الأجزاء مع الجينات المعروفة. تم أيضًا استخدام متغير من SAGE باستخدام تقنيات التسلسل عالية الإنتاجية ، يسمى تحليل التعبير الجيني الرقمي ، لفترة وجيزة. [9] [22] ومع ذلك ، تم تجاوز هذه الأساليب إلى حد كبير من خلال التسلسل عالي الإنتاجية للنصوص الكاملة ، والتي قدمت معلومات إضافية حول بنية النسخ مثل متغيرات لصق. [9]

تطوير التقنيات المعاصرة تحرير

مقارنة بين الأساليب المعاصرة [23] [24] [10]
RNA- تسلسل ميكروأري
الإنتاجية من يوم واحد إلى أسبوع واحد لكل تجربة [10] يوم إلى يومين لكل تجربة [10]
كمية المدخلات من الحمض النووي الريبي قليل

تم تطوير التقنيات المعاصرة السائدة ، المصفوفات الدقيقة و RNA-Seq ، في منتصف التسعينيات والعقد الأول من القرن الحادي والعشرين. [9] [33] نُشرت لأول مرة في عام 1995 المصفوفات الدقيقة التي تقيس وفرة مجموعة محددة من النصوص عبر تهجينها إلى مجموعة من المجسات التكميلية. انخفاض كبير في التكلفة لكل جين وتوفير العمالة. [36] كانت كل من مصفوفات قليل النوكليوتيد المرقط ومصفوفات Affymetrix عالية الكثافة هي الطريقة المفضلة لتحديد التنميط النسخي حتى أواخر العقد الأول من القرن الحادي والعشرين. [12] [33] خلال هذه الفترة ، تم إنتاج مجموعة من المصفوفات الدقيقة لتغطية الجينات المعروفة في النماذج أو الكائنات المهمة اقتصاديًا. أدى التقدم في تصميم وتصنيع المصفوفات إلى تحسين خصوصية المجسات والسماح باختبار المزيد من الجينات على مجموعة واحدة. أدى التقدم في الكشف عن التألق إلى زيادة الحساسية ودقة القياس للنصوص ذات الوفرة المنخفضة. [35] [37]

يتم إنجاز RNA-Seq عن طريق النسخ العكسي لـ RNA في المختبر وتسلسل cDNAs الناتجة. [10] يتم اشتقاق وفرة النسخ من عدد التهم من كل نسخة. لذلك تأثرت هذه التقنية بشكل كبير من خلال تطوير تقنيات التسلسل عالية الإنتاجية. [9] [11] كان تسلسل التوقيع المتوازي (MPSS) مثالًا مبكرًا يعتمد على توليد 16-20 تسلسلًا أساسيًا عبر سلسلة معقدة من التهجين ، [38] [الملاحظة 1] واستخدم في عام 2004 للتحقق من صحة التعبير عن عشرة ألف جين في نبات الأرابيدوبسيس thaliana. [39] نُشر أقدم عمل لـ RNA-Seq في عام 2006 مع مائة ألف نسخة متسلسلة باستخدام تقنية 454. [40] كانت هذه تغطية كافية لتقدير وفرة النسخ النسبية. بدأت شعبية RNA-Seq في الازدياد بعد عام 2008 عندما سمحت تقنيات Solexa / Illumina الجديدة بتسجيل مليار تسلسل نص. [4] [10] [41] [42] هذا الناتج يسمح الآن لتقدير ومقارنة النسخ البشرية. [43]

يمكن تحقيق توليد البيانات عن نصوص الحمض النووي الريبي عبر أي من مبدأين رئيسيين: تسلسل النصوص الفردية (ESTs ، أو RNA-Seq) أو تهجين النصوص إلى مجموعة مرتبة من تحقيقات النيوكليوتيدات (المصفوفات الدقيقة). [23]

عزل RNA تحرير

تتطلب جميع طرق النسخ RNA أن يتم عزله أولاً عن الكائن التجريبي قبل تسجيل النصوص. على الرغم من أن الأنظمة البيولوجية متنوعة بشكل لا يصدق ، فإن تقنيات استخراج الحمض النووي الريبي متشابهة إلى حد كبير وتتضمن التعطيل الميكانيكي للخلايا أو الأنسجة ، وتعطيل RNase بأملاح متقلبة ، [44] وتعطيل الجزيئات الكبيرة والمركبات النوكليوتيدية ، وفصل الحمض النووي الريبي عن الجزيئات الحيوية غير المرغوب فيها بما في ذلك الحمض النووي ، والتركيز من الحمض النووي الريبي عن طريق الترسيب من المحلول أو الشطف من مصفوفة صلبة. [44] [45] يمكن أيضًا معالجة الحمض النووي الريبي المعزول باستخدام الدناز لهضم أي آثار للحمض النووي. [46] من الضروري إثراء الرنا المرسال حيث أن إجمالي مستخلصات الرنا تكون عادةً 98٪ من الرنا الريبوزومي. [47] يمكن إجراء الإثراء للنصوص بواسطة طرق تقارب poly-A أو عن طريق استنفاد RNA الريبوسوم باستخدام تحقيقات خاصة بالتسلسل. [48] ​​قد يؤثر الحمض النووي الريبي المتدهور على نتائج المصب على سبيل المثال ، سيؤدي تخصيب الرنا المرسال من العينات المتدهورة إلى استنفاد 5 نهايات من الرنا المرسال وإشارة غير متساوية عبر طول النص. يعد التجميد المفاجئ للأنسجة قبل عزل الحمض النووي الريبي أمرًا نموذجيًا ، ويتم الحرص على تقليل التعرض لإنزيمات RNase بمجرد اكتمال العزل. [45]

معبر عن تسلسل العلامات تحرير

علامة التسلسل المعبر عنها (EST) هي تسلسل نيوكليوتيد قصير يتم إنشاؤه من نسخة واحدة من الحمض النووي الريبي.يتم نسخ الحمض النووي الريبي (RNA) أولاً على أنه DNA تكميلي (cDNA) بواسطة إنزيم النسخ العكسي قبل تسلسل cDNA الناتج. [16] نظرًا لأنه يمكن جمع ESTs دون معرفة مسبقة بالكائن الحي الذي أتت منه ، فيمكن صنعها من خليط من الكائنات الحية أو العينات البيئية. [49] [16] على الرغم من استخدام طرق الإنتاجية العالية الآن ، فقد قدمت مكتبات EST بشكل عام معلومات تسلسلية لتصميمات المصفوفات الدقيقة المبكرة على سبيل المثال ، تم تصميم مصفوفة الشعير الدقيقة من 350.000 EST متسلسلة مسبقًا. [50]

تحليل المسلسل والغطاء للتعبير الجيني (SAGE / CAGE) تحرير

كان التحليل التسلسلي للتعبير الجيني (SAGE) تطويرًا لمنهجية EST لزيادة إنتاجية العلامات التي تم إنشاؤها والسماح ببعض التقدير الكمي لوفرة النص. [21] يتم إنشاء (كدنا) من الحمض النووي الريبي (RNA) ولكن يتم هضمه بعد ذلك إلى شظايا "علامة" 11 زوجًا أساسًا باستخدام إنزيمات التقييد التي تقطع الحمض النووي في تسلسل معين ، و 11 زوجًا قاعديًا على طول هذا التسلسل. يتم بعد ذلك ربط علامات (كدنا) هذه وجهاً لوجه في خيوط طويلة (& gt500 bp) وتسلسلها باستخدام طرق قراءة منخفضة الإنتاجية وطويلة مثل تسلسل Sanger. ثم يتم تقسيم التسلسلات مرة أخرى إلى علامات 11 نقطة أساس باستخدام برامج الكمبيوتر في عملية تسمى deconvolution. [21] في حالة توفر جينوم مرجعي عالي الجودة ، يمكن مطابقة هذه العلامات مع الجين المقابل لها في الجينوم. إذا كان الجينوم المرجعي غير متاح ، فيمكن استخدام العلامات مباشرة كعلامات تشخيصية إذا تم التعبير عنها بشكل مختلف في حالة المرض. [21]

طريقة التعبير الجيني لتحليل الغطاء (CAGE) هي أحد أشكال SAGE التي تسلسل العلامات من نهاية 5 'من نسخة mRNA فقط. [52] لذلك ، يمكن تحديد موقع بدء النسخ للجينات عند محاذاة العلامات مع جينوم مرجعي. يعد تحديد مواقع بدء الجينات مفيدًا لتحليل المروج واستنساخ cDNAs كاملة الطول.

تنتج طريقتا SAGE و CAGE معلومات عن جينات أكثر مما كان ممكنًا عند تسلسل ESTs الفردية ، لكن تحضير العينات وتحليل البيانات عادة ما يكونان أكثر كثافة في العمل. [52]

تحرير المصفوفات الدقيقة

المبادئ والتطورات تحرير

تتكون المصفوفات الدقيقة من أوليغومرات نيوكليوتيد قصيرة ، تُعرف باسم "المجسات" ، والتي يتم ترتيبها عادةً في شبكة على شريحة زجاجية. [53] يتم تحديد وفرة النسخ عن طريق تهجين النصوص ذات العلامات الفلورية لهذه المجسات. [54] تشير شدة التألق في كل موقع مسبار على المصفوفة إلى وفرة النسخ لتسلسل المسبار هذا. [54]

تتطلب المصفوفات الدقيقة بعض المعرفة الجينومية من الكائن الحي محل الاهتمام ، على سبيل المثال ، في شكل تسلسل الجينوم المشروح ، أو مكتبة من ESTs التي يمكن استخدامها لإنشاء تحقيقات للمصفوفة. [36]

طرق تحرير

عادةً ما تندرج المصفوفات الدقيقة الخاصة بالنسخ في إحدى فئتين عريضتين: المصفوفات المرقطة منخفضة الكثافة أو المصفوفات القصيرة عالية الكثافة. يتم الاستدلال على وفرة النسخ من شدة التألق المستمدة من النصوص ذات العلامات الفلورية التي ترتبط بالمصفوفة. [36]

تتميز المصفوفات ذات الكثافة المنخفضة المرقطة عادةً بقطرات بيكوليتر [الملاحظة 2] من مجموعة من cDNAs المنقى مصفوفة على سطح شريحة زجاجية. [55] هذه المجسات أطول من تلك الخاصة بالمصفوفات عالية الكثافة ولا يمكنها تحديد أحداث التضفير البديلة. تستخدم المصفوفات المرقطة نوعين مختلفين من الفلوروفور لتسمية عينات الاختبار والتحكم ، وتستخدم نسبة التألق لحساب مقياس نسبي للوفرة. [56] تستخدم المصفوفات عالية الكثافة تسمية فلورية واحدة ، ويتم تهجين كل عينة واكتشافها على حدة. [57] انتشرت المصفوفات عالية الكثافة من خلال مصفوفة Affymetrix GeneChip ، حيث يتم تحديد كمية كل نسخة عن طريق عدة تحقيقات قصيرة من 25 مير والتي تفحص معًا جينًا واحدًا. [58]

كانت صفائف NimbleGen عبارة عن مصفوفة عالية الكثافة تنتجها طريقة الكيمياء الضوئية بدون قناع ، والتي سمحت بتصنيع مرن للمصفوفات بأعداد صغيرة أو كبيرة. كانت هذه المصفوفات تحتوي على 100000 مجس من 45 إلى 85 مير وتم تهجينها بعينة ذات لون واحد لتحليل التعبير. [59] تضمنت بعض التصميمات ما يصل إلى 12 مصفوفة مستقلة لكل شريحة.

تحرير تسلسل RNA

المبادئ والتطورات تحرير

يشير RNA-Seq إلى مزيج من منهجية التسلسل عالية الإنتاجية مع الأساليب الحسابية لالتقاط وقياس النصوص الموجودة في مستخلص الحمض النووي الريبي. [10] يبلغ طول تسلسل النوكليوتيدات المتولدة حوالي 100 نقطة أساس ، ولكن يمكن أن يتراوح من 30 نقطة أساس إلى أكثر من 10000 نقطة أساس اعتمادًا على طريقة التسلسل المستخدمة. يستفيد RNA-Seq من أخذ عينات عميقة من النسخة مع العديد من الأجزاء القصيرة من نسخة للسماح بإعادة البناء الحسابي لنسخة RNA الأصلية عن طريق محاذاة القراءات إلى جينوم مرجعي أو مع بعضها البعض (تجميع de novo). [9] يمكن تحديد كمية الرنا منخفضة الوفرة وعالية الوفرة في تجربة RNA-Seq (نطاق ديناميكي من 5 أوامر من حيث الحجم) - وهي ميزة رئيسية على نسخ المصفوفات الدقيقة. بالإضافة إلى ذلك ، فإن كميات إدخال الحمض النووي الريبي (RNA) أقل بكثير بالنسبة لـ RNA-Seq (كمية نانوجرام) مقارنة بالمصفوفات الدقيقة (كمية ميكروغرام) ، مما يسمح بفحص أدق للهياكل الخلوية وصولاً إلى مستوى الخلية المفردة عندما يقترن بالتضخيم الخطي لـ (كدنا). [25] [60] نظريًا ، لا يوجد حد أعلى للقياس الكمي في تسلسل الحمض النووي الريبي ، وضوضاء الخلفية منخفضة جدًا لقراءات 100 نقطة أساس في المناطق غير المتكررة. [10]

يمكن استخدام RNA-Seq لتحديد الجينات داخل الجينوم ، أو تحديد الجينات النشطة في نقطة زمنية معينة ، ويمكن استخدام أعداد القراءة لنمذجة مستوى التعبير الجيني النسبي بدقة. لقد تحسنت منهجية RNA-Seq باستمرار ، في المقام الأول من خلال تطوير تقنيات تسلسل الحمض النووي لزيادة الإنتاجية والدقة وطول القراءة. [61] منذ الأوصاف الأولى في عامي 2006 و 2008 ، [40] [62] تم اعتماد RNA-Seq بسرعة وتجاوز المصفوفات الدقيقة باعتبارها تقنية النسخ السائدة في عام 2015. [63]

أدى البحث عن بيانات النسخ على مستوى الخلايا الفردية إلى إحداث تقدم في أساليب إعداد مكتبة RNA-Seq ، مما أدى إلى تطورات مثيرة في الحساسية. يتم الآن وصف نسخ الخلية المفردة جيدًا وقد تم تمديدها حتى فى الموقع RNA-Seq حيث يتم استجواب نسخ الخلايا الفردية مباشرة في الأنسجة الثابتة. [64]

طرق تحرير

تم إنشاء RNA-Seq بالتنسيق مع التطور السريع لمجموعة من تقنيات تسلسل الحمض النووي عالية الإنتاجية. [65] ومع ذلك ، قبل أن يتم تسلسل نسخ RNA المستخرجة ، يتم تنفيذ العديد من خطوات المعالجة الرئيسية. تختلف الطرق في استخدام إثراء النص ، والتجزئة ، والتضخيم ، والتسلسل الفردي أو المزدوج ، وما إذا كان يجب الحفاظ على معلومات الخيوط. [65]

يمكن زيادة حساسية تجربة RNA-Seq عن طريق إثراء فئات من الحمض النووي الريبي (RNA) ذات الأهمية واستنفاد الحمض النووي الريبي المعروف الوفير. يمكن فصل جزيئات mRNA باستخدام تحقيقات oligonucleotides التي تربط ذيول poly-A الخاصة بهم. بدلاً من ذلك ، يمكن استخدام استنفاد الريبو لإزالة الحمض النووي الريبوزي الوفير ولكنه غير مفيد على وجه التحديد عن طريق التهجين إلى تحقيقات مصممة لتسلسل الرنا الريباسي المحدد (مثل الرنا الريباسي للثدييات ، الرنا الريباسي النباتي). ومع ذلك ، يمكن أن يؤدي استنفاد الضلع أيضًا إلى بعض التحيز عبر الاستنفاد غير المحدد للنصوص غير المستهدفة. [66] يمكن تنقية الرنا الصغيرة ، مثل الرنا الميكروي ، بناءً على حجمها عن طريق الرحلان الكهربائي للهلام والاستخلاص.

نظرًا لأن mRNAs أطول من أطوال القراءة الخاصة بأساليب التسلسل عالية الإنتاجية النموذجية ، فعادة ما يتم تجزئة النصوص قبل التسلسل. [67] تعتبر طريقة التجزئة جانبًا أساسيًا من بناء مكتبة التسلسل. يمكن تحقيق التفتت عن طريق التحليل المائي الكيميائي ، أو الإرذاذ ، أو الصوتنة ، أو النسخ العكسي باستخدام النيوكليوتيدات المنتهية بالسلسلة. [67] بدلاً من ذلك ، يمكن أن يتم التفتيت ووسم cDNA في وقت واحد باستخدام إنزيمات transposase. [68]

أثناء التحضير للتسلسل ، قد يتم تضخيم نسخ cDNA من النصوص بواسطة PCR لإثراء الأجزاء التي تحتوي على تسلسل المحول المتوقع 5 و 3. [69] يستخدم التضخيم أيضًا للسماح بتسلسل كميات إدخال منخفضة جدًا من الحمض النووي الريبي ، وصولاً إلى أقل من 50 بيكوغرام في التطبيقات المتطرفة. [70] يمكن استخدام ضوابط الزيادة في RNAs المعروفة لتقييم مراقبة الجودة للتحقق من إعداد المكتبة وتسلسلها ، من حيث محتوى GC ، وطول القطعة ، بالإضافة إلى التحيز بسبب موضع القطعة داخل النص. [71] المعرفات الجزيئية الفريدة (UMIs) عبارة عن تسلسلات عشوائية قصيرة تُستخدم لتمييز الأجزاء المتسلسلة بشكل فردي أثناء إعداد المكتبة بحيث يكون كل جزء مميز فريدًا. [72] توفر UMIs مقياسًا مطلقًا للتقدير الكمي ، وفرصة لتصحيح تحيز التضخيم اللاحق الذي تم تقديمه أثناء إنشاء المكتبة ، وتقدير حجم العينة الأولي بدقة. تعتبر UMIs مناسبة بشكل خاص لنسخ RNA-Seq أحادية الخلية ، حيث يتم تقييد كمية إدخال الحمض النووي الريبي (RNA) والتضخيم الموسع للعينة مطلوبًا. [73] [74] [75]

بمجرد أن يتم تحضير جزيئات النص ، يمكن تسلسلها في اتجاه واحد فقط (طرف واحد) أو كلا الاتجاهين (نهاية مزدوجة). عادةً ما يكون إنتاج التسلسل أحادي النهاية أسرع ، وأرخص من التسلسل ثنائي النهاية وكافٍ لتقدير مستويات التعبير الجيني. ينتج عن التسلسل المزدوج النهاية محاذاة / تجميعات أكثر قوة ، وهو أمر مفيد للتعليق التوضيحي للجينات واكتشاف الشكل الإسوي للنسخ. [10] تحافظ طرق RNA-Seq الخاصة بالجدار على معلومات حبلا من نسخة متسلسلة. [76] بدون معلومات الخيط ، يمكن محاذاة القراءات مع موضع الجين ولكن لا تخبر في أي اتجاه يتم نسخ الجين. يعد Stranded-RNA-Seq مفيدًا لفك تشفير النسخ للجينات التي تتداخل في اتجاهات مختلفة ولإجراء تنبؤات جينية أكثر قوة في الكائنات الحية غير النموذجية. [76]

منصات تكنولوجيا التسلسل المستخدمة بشكل شائع لـ RNA-Seq [77] [78]
برنامج الافراج التجاري طول القراءة النموذجي أقصى سرعة لكل شوط دقة قراءة واحدة عمليات تشغيل RNA-Seq المودعة في NCBI SRA (أكتوبر 2016) [79]
454 علوم الحياة 2005 700 بي بي 0.7 جيجابت 99.9% 3548
إلومينا 2006 50 - 300 سنة مضت 900 جيجابت 99.9% 362903
صلب 2008 50 زوجا 320 جيجابت 99.9% 7032
ايون تورنت 2010 400 نقطة أساس 30 جيجابت 98% 1953
باكبيو 2011 10000 نقطة أساس 2 جيجابت 87% 160

مفتاح إيضاح: NCBI SRA - أرشيف قراءة تسلسل معلومات التكنولوجيا الحيوية للمركز الوطني.

يعتمد RNA-Seq حاليًا على نسخ جزيئات الحمض النووي الريبي إلى جزيئات (كدنا) قبل التسلسل ، وبالتالي ، فإن المنصات اللاحقة هي نفسها بالنسبة لبيانات النسخ والجينوم. وبالتالي ، كان تطوير تقنيات تسلسل الحمض النووي سمة مميزة لـ RNA-Seq. [78] [80] [81] التسلسل المباشر للحمض النووي الريبي باستخدام التسلسل النانوي يمثل أحدث تقنيات RNA-Seq الحالية. [82] [83] يمكن لتسلسل النانو للحمض النووي الريبي الكشف عن القواعد المعدلة التي يمكن أن يتم حجبها عند تسلسل الحمض النووي الريبي وأيضًا التخلص من خطوات التضخيم التي يمكن أن تؤدي إلى التحيز. [11] [84]

تعتمد حساسية ودقة تجربة RNA-Seq على عدد القراءات التي تم الحصول عليها من كل عينة. [85] [86] هناك حاجة إلى عدد كبير من القراءات لضمان التغطية الكافية للنسخة ، مما يتيح الكشف عن النصوص ذات الوفرة المنخفضة. يزداد التصميم التجريبي تعقيدًا عن طريق تقنيات التسلسل ذات نطاق الإخراج المحدود ، والكفاءة المتغيرة لإنشاء التسلسل ، وجودة التسلسل المتغير. يضاف إلى هذه الاعتبارات أن لكل نوع عددًا مختلفًا من الجينات ، وبالتالي يتطلب إنتاج تسلسل مخصص لنسخة فعالة. حددت الدراسات المبكرة عتبات مناسبة تجريبيًا ، ولكن مع نضوج التكنولوجيا ، تم التنبؤ بالتغطية المناسبة حسابياً عن طريق تشبع النسخ. الطريقة الأكثر فعالية لتحسين الكشف عن التعبير التفاضلي في الجينات منخفضة التعبير هي إضافة المزيد من التكرارات البيولوجية بدلاً من إضافة المزيد من القراءات. [87] المعايير الحالية التي أوصى بها مشروع موسوعة عناصر الحمض النووي (ENCODE) هي لتغطية الإكسوم 70 ضعفًا لـ RNA-Seq القياسي وتغطية إكسوم تصل إلى 500 ضعف لاكتشاف النسخ والأشكال الإسوية النادرة. [88] [89] [90]

تعتبر طرق النسخ متوازية للغاية وتتطلب حسابًا كبيرًا لإنتاج بيانات ذات مغزى لكل من تجارب ميكروأري و RNA-Seq. [91] [92] [93] [94] يتم تسجيل بيانات المصفوفات الدقيقة كصور عالية الدقة ، مما يتطلب اكتشاف الميزات والتحليل الطيفي. [95] يبلغ حجم كل ملف من ملفات الصور الأولية Microarray حوالي 750 ميجابايت ، بينما يبلغ حجم الشدة المعالجة حوالي 60 ميجابايت. يمكن أن تكشف التحقيقات القصيرة المتعددة التي تتطابق مع نسخة واحدة عن تفاصيل حول بنية intron-exon ، مما يتطلب نماذج إحصائية لتحديد مصداقية الإشارة الناتجة. تنتج دراسات RNA-Seq بلايين من سلاسل الحمض النووي القصيرة ، والتي يجب أن تتماشى مع الجينومات المرجعية المكونة من ملايين إلى مليارات أزواج القواعد. من جديد يتطلب تجميع القراءات داخل مجموعة بيانات إنشاء رسوم بيانية تسلسلية معقدة للغاية. [96] عمليات RNA-Seq شديدة التكرار وتستفيد من الحساب المتوازي ، لكن الخوارزميات الحديثة تعني أن أجهزة الحوسبة الاستهلاكية كافية لتجارب النسخ البسيطة التي لا تتطلب من جديد تجميع القراءات. [97] يمكن التقاط نسخة بشرية بدقة باستخدام RNA-Seq مع 30 مليون تسلسل 100 زوج قاعدي لكل عينة. [85] [86] يتطلب هذا المثال حوالي 1.8 جيجا بايت من مساحة القرص لكل عينة عند تخزينها في تنسيق fastq مضغوط. ستكون بيانات العد المعالج لكل جين أصغر بكثير ، أي ما يعادل شدة ميكروأري المعالجة. قد يتم تخزين بيانات التسلسل في مستودعات عامة ، مثل أرشيف قراءة التسلسل (SRA). [98] يمكن تحميل مجموعات بيانات RNA-Seq عبر Gene Expression Omnibus. [99]

تحرير معالجة الصور

يجب أن تحدد معالجة الصور بالميكروأري بشكل صحيح الشبكة العادية للميزات داخل صورة وأن تحدد بشكل مستقل شدة التألق لكل ميزة. بالإضافة إلى ذلك ، يجب تحديد القطع الأثرية للصورة وإزالتها من التحليل العام. تشير شدة الإسفار مباشرة إلى وفرة كل تسلسل ، حيث أن تسلسل كل مسبار في الصفيف معروف بالفعل. [101]

تتضمن الخطوات الأولى لـ RNA-seq أيضًا معالجة صور مماثلة ، ومع ذلك ، عادةً ما يتم التعامل مع تحويل الصور إلى بيانات متسلسلة تلقائيًا بواسطة برنامج الجهاز. ينتج عن طريقة تسلسل Illumina عن طريق التوليف مجموعة من المجموعات الموزعة على سطح خلية التدفق. [102] يتم تصوير خلية التدفق حتى أربع مرات خلال كل دورة تسلسل ، مع عشرات إلى مئات الدورات في المجموع. مجموعات خلايا التدفق مماثلة لبقع ميكروأري ويجب تحديدها بشكل صحيح خلال المراحل الأولى من عملية التسلسل. في طريقة Roche للتسلسل الحراري ، تحدد شدة الضوء المنبعث عدد النيوكليوتيدات المتتالية في تكرار البوليمر المتجانس. هناك العديد من المتغيرات في هذه الطرق ، ولكل منها ملف تعريف خطأ مختلف للبيانات الناتجة. [103]

تحليل بيانات RNA-Seq تحرير

تولد تجارب RNA-Seq حجمًا كبيرًا من قراءات التسلسل الأولي التي يجب معالجتها للحصول على معلومات مفيدة. يتطلب تحليل البيانات عادةً مجموعة من أدوات برمجيات المعلوماتية الحيوية (انظر أيضًا قائمة أدوات المعلوماتية الحيوية RNA-Seq) التي تختلف وفقًا للتصميم والأهداف التجريبية. يمكن تقسيم العملية إلى أربع مراحل: مراقبة الجودة ، والمحاذاة ، والقياس الكمي ، والتعبير التفاضلي. [104] يتم تشغيل برامج RNA-Seq الأكثر شيوعًا من واجهة سطر الأوامر ، إما في بيئة Unix أو ضمن بيئة R / Bioconductor الإحصائية. [93]

تعديل مراقبة الجودة

قراءات التسلسل ليست مثالية ، لذلك يجب تقدير دقة كل قاعدة في التسلسل لتحليلات المصب. يتم فحص البيانات الأولية للتأكد من: درجات الجودة للمكالمات الأساسية عالية ، ومحتوى GC يطابق التوزيع المتوقع ، والزخارف المتسلسلة القصيرة (k-mers) ليست ممثلة بشكل مفرط ، ومعدل تكرار القراءة منخفض بشكل مقبول. [86] توجد عدة خيارات برمجية لتحليل جودة التسلسل ، بما في ذلك FastQC و FaQCs. [105] [106] يمكن إزالة التشوهات (التشذيب) أو تمييزها بمعاملة خاصة خلال عمليات لاحقة.

تحرير المحاذاة

من أجل ربط تسلسل قراءة الوفرة بالتعبير عن جين معين ، يتم محاذاة تسلسل النسخ إلى جينوم مرجعي أو من جديد تتماشى مع بعضها البعض إذا لم يكن هناك مرجع متاح. [107] [108] [109] تتضمن التحديات الرئيسية لبرمجيات المحاذاة سرعة كافية للسماح بمحاذاة بلايين التسلسلات القصيرة في إطار زمني ذي مغزى ، والمرونة للتعرف والتعامل مع تضفير intron لـ mRNA حقيقية النواة ، والتخصيص الصحيح للقراءات التي خريطة لمواقع متعددة. لقد عالجت التطورات في البرامج هذه المشكلات بشكل كبير ، كما أن الزيادات في طول قراءة التسلسل تقلل من فرصة محاذاة القراءة الغامضة. يحتفظ EBI بقائمة بمحاذاة التسلسل عالية الإنتاجية المتوفرة حاليًا. [110] [111]

تتطلب محاذاة تسلسلات mRNA للنسخة الأولية المشتقة من حقيقيات النوى إلى جينوم مرجعي معالجة متخصصة لتسلسلات intron ، والتي لا توجد في mRNA الناضج. [112] تقوم أدوات محاذاة القراءة القصيرة بإجراء جولة إضافية من المحاذاة المصممة خصيصًا لتحديد الوصلات الملصقة ، مستنيرة من خلال تسلسل موقع لصق الكنسي ومعلومات موقع لصق إنترون المعروفة. إن تحديد تقاطعات لصق intron يمنع القراءات من أن تكون غير محاذاة عبر تقاطعات الوصلات أو يتم إهمالها عن طريق الخطأ ، مما يسمح بمحاذاة المزيد من القراءات مع الجينوم المرجعي وتحسين دقة تقديرات التعبير الجيني. نظرًا لأن تنظيم الجينات قد يحدث على مستوى الشكل الإسوي للـ mRNA ، فإن المحاذاة الواعية للوصلة تسمح أيضًا باكتشاف تغييرات وفرة الشكل الإسوي التي قد تُفقد في تحليل مجمّع. [113]

من جديد يمكن استخدام التجميع لمحاذاة القراءات مع بعضها البعض لإنشاء تسلسلات نصية كاملة الطول دون استخدام جينوم مرجعي. [114] التحديات الخاصة من جديد يتضمن التجميع متطلبات حسابية أكبر مقارنة بالنسخة المرجعية ، والتحقق الإضافي من المتغيرات الجينية أو الأجزاء ، والتعليق التوضيحي الإضافي للنصوص المجمعة. لقد ثبت أن المقاييس الأولى المستخدمة لوصف تجميعات النسخ ، مثل N50 ، مضللة [115] وأن طرق التقييم المحسنة متاحة الآن. [116] [117] تعد المقاييس المستندة إلى التعليقات التوضيحية تقييمات أفضل لاكتمال التجميع ، مثل العد المتبادل لأفضل النتائج المتجاورة. يتم تجميعها مرة واحدة من جديد، يمكن استخدام التجميع كمرجع لطرق محاذاة التسلسل اللاحقة وتحليل التعبير الجيني الكمي.

RNA- تسلسل من جديد برنامج التجميع
برمجة مطلق سراحه التحديث الاخير الكفاءة الحسابية نقاط القوة والضعف
الواحات المخملية [118] [119] 2008 2011 متطلبات ذاكرة الوصول العشوائي منخفضة ، أحادية الخيوط ، عالية مُجمّع القراءة القصيرة الأصلي. تم استبداله الآن إلى حد كبير.
سوابدينوفو ترانس [108] 2011 2014 متطلبات ذاكرة الوصول العشوائي المعتدلة ومتعددة الخيوط والمتوسطة مثال مبكر لمجمع قراءة قصيرة. تم تحديثه لتجميع النسخ.
Trans-ABySS [120] 2010 2016 متطلبات ذاكرة الوصول العشوائي المعتدلة ومتعددة الخيوط والمتوسطة مناسبة للقراءات القصيرة ، ويمكنها التعامل مع النسخ المعقدة ، ويتوفر إصدار MPI المتوازي لحوسبة المجموعات.
الثالوث [121] [96] 2011 2017 متطلبات ذاكرة الوصول العشوائي المعتدلة ومتعددة الخيوط والمتوسطة مناسبة للقراءات القصيرة. يمكنه التعامل مع النسخ المعقدة ولكنها تتطلب ذاكرة مكثفة.
ميريست [122] 1999 2016 متطلبات ذاكرة الوصول العشوائي المعتدلة ومتعددة الخيوط والمتوسطة يمكن معالجة التسلسلات المتكررة ، والجمع بين تنسيقات التسلسل المختلفة ، ويتم قبول مجموعة واسعة من أنظمة التسلسل.
نيوبلير [123] 2004 2012 متطلبات ذاكرة الوصول العشوائي منخفضة ، أحادية الخيط ، عالية متخصص لاستيعاب أخطاء تسلسل البوليمر المتماثل النموذجي لمسلسلات Roche 454.
منضدة علم الجينوم CLC [124] 2008 2014 متطلبات ذاكرة الوصول العشوائي عالية ومتعددة الخيوط ومنخفضة يحتوي على واجهة مستخدم رسومية ، ويمكنه الجمع بين تقنيات التسلسل المتنوعة ، ولا يحتوي على ميزات خاصة بالنسخة ، ويجب شراء ترخيص قبل الاستخدام.
SPAdes [125] 2012 2017 متطلبات ذاكرة الوصول العشوائي عالية ومتعددة الخيوط ومنخفضة تستخدم لتجارب النسخ على الخلايا المفردة.
RSEM [126] 2011 2017 متطلبات ذاكرة الوصول العشوائي عالية ومتعددة الخيوط ومنخفضة يمكن تقدير تواتر النصوص المقسمة بدلاً من ذلك. سهل الاستخدام.
سلسلة [97] [127] 2015 2019 متطلبات ذاكرة الوصول العشوائي عالية ومتعددة الخيوط ومنخفضة يمكن استخدام مزيج من الموجهات المرجعية و من جديد طرق التجميع لتحديد النصوص.

وسيلة إيضاح: RAM - ذاكرة الوصول العشوائي MPI - واجهة تمرير الرسائل EST - علامة التسلسل المعبر عنها.

تحرير القياس الكمي

يمكن إجراء التحديد الكمي لمحاذاة التسلسل على مستوى الجين أو إكسون أو نسخة. [87] تشتمل المخرجات النموذجية على جدول بأعداد القراءة لكل ميزة يتم توفيرها للبرنامج على سبيل المثال ، للجينات في ملف تنسيق ميزة عامة. يمكن حساب عدد قراءة الجينات والإكسون بسهولة تامة باستخدام HTSeq ، على سبيل المثال. [129] يعتبر القياس الكمي على مستوى النص أكثر تعقيدًا ويتطلب طرقًا احتمالية لتقدير وفرة النص الإسوي من معلومات القراءة القصيرة على سبيل المثال ، باستخدام برنامج أزرار الكم. [113] يجب تحديد القراءات التي تتماشى جيدًا مع مواقع متعددة وإما إزالتها أو محاذاة أحد المواقع المحتملة أو مواءمتها مع الموقع الأكثر احتمالية.

يمكن لبعض طرق القياس الكمي الالتفاف على الحاجة إلى محاذاة دقيقة للقراءة إلى تسلسل مرجعي تمامًا. تجمع طريقة برنامج kallisto بين المحاذاة الزائفة والقياس الكمي في خطوة واحدة تعمل على تنفيذ 2 أوامر من حيث الحجم أسرع من الأساليب المعاصرة مثل تلك المستخدمة بواسطة برنامج tophat / cufflinks ، مع عبء حسابي أقل. [130]

تحرير التعبير التفاضلي

بمجرد توفر التعداد الكمي لكل نسخة ، يتم قياس التعبير الجيني التفاضلي عن طريق تطبيع البيانات والنمذجة والتحليل الإحصائي لها. [107] ستقرأ معظم الأدوات جدولًا للجينات وتعداد القراءة كمدخلات لها ، لكن بعض البرامج ، مثل cuffdiff ، ستقبل محاذاة قراءة تنسيق خريطة المحاذاة الثنائية كمدخلات. النواتج النهائية لهذه التحليلات هي قوائم الجينات المصحوبة باختبارات زوجية مرتبطة بالتعبير التفاضلي بين العلاجات وتقديرات الاحتمالية لتلك الاختلافات. [131]

برنامج التعبير الجيني التفاضلي RNA-Seq
برمجة بيئة تخصص
Cuffdiff2 [107] يونكس تحليل النسخ الذي يتتبع التضفير البديل لـ mRNA
EdgeR [92] ص / موصل حيوي أي بيانات الجينوم القائمة على العد
DEseq2 [132] ص / موصل حيوي أنواع بيانات مرنة ، تكرار منخفض
ليما / فوم [91] ص / موصل حيوي بيانات Microarray أو RNA-Seq ، تصميم تجربة مرن
ثوب فضفاض [133] ص / موصل حيوي اكتشاف النصوص فعالة وحساسة ومرنة.

الأسطورة: mRNA - messenger RNA.

تحرير التحقق من الصحة

يمكن التحقق من صحة تحليلات النسخ باستخدام تقنية مستقلة ، على سبيل المثال ، PCR الكمي (qPCR) ، والتي يمكن التعرف عليها وتقييمها إحصائيًا. [134] يتم قياس التعبير الجيني مقابل معايير محددة لكل من الجينات المعنية والجينات الضابطة. القياس بواسطة qPCR مشابه للقياس الذي تم الحصول عليه بواسطة RNA-Seq حيث يمكن حساب قيمة لتركيز المنطقة المستهدفة في عينة معينة. ومع ذلك ، فإن qPCR مقصور على amplicons الأصغر من 300 نقطة أساس ، وعادةً ما تكون باتجاه الطرف 3 من منطقة الترميز ، مع تجنب 3’UTR. [135] إذا كان التحقق من صحة النسخ الإسوية مطلوبًا ، فيجب أن يشير فحص محاذاة قراءة RNA-Seq إلى المكان الذي يمكن وضع بادئات qPCR فيه للتمييز الأقصى. ينتج عن قياس جينات التحكم المتعددة جنبًا إلى جنب مع الجينات ذات الأهمية مرجعًا ثابتًا ضمن سياق بيولوجي. [136] أظهر التحقق من صحة qPCR لبيانات RNA-Seq عمومًا أن طرق RNA-Seq المختلفة مترابطة بشكل كبير. [62] [137] [138]

يعد التحقق الوظيفي للجينات الرئيسية من الاعتبارات المهمة للتخطيط بعد النسخ. قد ترتبط أنماط التعبير الجيني المرصودة وظيفيًا بنمط ظاهري من خلال دراسة مفككة / إنقاذ مستقلة في الكائن الحي محل الاهتمام. [139]

التشخيصات وتحديد ملامح المرض

شهدت استراتيجيات النسخ تطبيقًا واسعًا عبر مجالات متنوعة من البحوث الطبية الحيوية ، بما في ذلك تشخيص المرض والتنميط. [10] [140] سمحت مناهج تسلسل الحمض النووي الريبي بالتعريف على نطاق واسع لمواقع بدء النسخ ، واستخدام المروج البديل المكشوف ، وتعديلات الربط الجديدة. هذه العناصر التنظيمية مهمة في مرض الإنسان ، وبالتالي ، فإن تحديد مثل هذه المتغيرات أمر بالغ الأهمية لتفسير دراسات ارتباط المرض. [141] يمكن أيضًا أن يحدد RNA-Seq تعدد أشكال النوكليوتيدات المفردة المرتبطة بالأمراض ، والتعبير الخاص بالأليل ، واندماج الجينات ، مما يساهم في فهم المتغيرات المسببة للمرض. [142]

الينقولات الرجعية هي عناصر قابلة للنقل تتكاثر داخل جينومات حقيقية النواة من خلال عملية تتضمن النسخ العكسي. يمكن أن يوفر RNA-Seq معلومات حول نسخ الينقولات العكسية الذاتية التي قد تؤثر على نسخ الجينات المجاورة بواسطة آليات جينية مختلفة تؤدي إلى المرض. [143] وبالمثل ، فإن إمكانية استخدام RNA-Seq لفهم الأمراض المرتبطة بالمناعة تتوسع بسرعة بسبب القدرة على تشريح مجموعات الخلايا المناعية وتسلسل ذخيرة مستقبلات الخلايا التائية والخلايا البائية من المرضى. [144] [145]

تحرير النسخ البشرية ومسببات الأمراض

أصبح RNA-Seq لمسببات الأمراض البشرية طريقة راسخة لقياس تغيرات التعبير الجيني ، وتحديد عوامل الفوعة الجديدة ، والتنبؤ بمقاومة المضادات الحيوية ، وكشف النقاب عن التفاعلات المناعية للمضيف الممرض. [146] [147] الهدف الأساسي لهذه التقنية هو تطوير تدابير مكافحة العدوى المثلى والعلاج الفردي المستهدف. [145]

ركز تحليل النسخ في الغالب على المضيف أو الممرض. تم تطبيق Dual RNA-Seq لتشكيل تعبير RNA في وقت واحد في كل من الممرض والمضيف طوال عملية العدوى. تتيح هذه التقنية دراسة الاستجابة الديناميكية وشبكات تنظيم الجينات بين الأنواع في كل من شركاء التفاعل من الاتصال الأولي وحتى الغزو والثبات النهائي للعامل الممرض أو التطهير بواسطة الجهاز المناعي المضيف. [148] [149]

الردود على البيئة تحرير

يسمح علم النسخ بتحديد الجينات والمسارات التي تستجيب للضغوط البيئية الحيوية وغير الحيوية وتتصدى لها. [150] [139] تسمح الطبيعة غير المستهدفة للنصوص بتحديد شبكات النسخ الجديدة في الأنظمة المعقدة. على سبيل المثال ، حدد التحليل المقارن لمجموعة من سلالات الحمص في مراحل نمو مختلفة ملامح نسخ متميزة مرتبطة بضغوط الجفاف والملوحة ، بما في ذلك تحديد دور الأشكال الإسوية للنسخة من AP2-EREBP. [150] التحقيق في التعبير الجيني عن طريق مسببات الأمراض الفطرية أثناء تكوين الأغشية الحيوية المبيضات البيض كشف مجموعة منظمة مشتركة من الجينات الضرورية لإنشاء الأغشية الحيوية وصيانتها. [151]

يوفر التنميط النسخي أيضًا معلومات مهمة حول آليات مقاومة الأدوية. تحليل أكثر من 1000 عزلة من المتصورة المنجلية، وهو طفيلي خبيث مسؤول عن الملاريا لدى البشر ، [152] حدد أن زيادة تنظيم استجابة البروتين غير المكشوفة والتقدم البطيء خلال المراحل المبكرة من دورة النمو اللاجنسي داخل كرات الدم الحمراء كانا مرتبطين بمقاومة مادة الأرتيميسينين في عزلات من جنوب شرق آسيا. [153]

تعديل شرح الوظيفة الجينية

كانت جميع تقنيات النسخ مفيدة بشكل خاص في تحديد وظائف الجينات وتحديد المسؤولين عن أنماط ظاهرية معينة. ترانسكريبتوميكس من أرابيدوبسيس الأنماط البيئية التي تتراكم المعادن بشكل مفرط ترتبط بالجينات المشاركة في امتصاص المعادن ، والتسامح ، والتوازن مع النمط الظاهري. [154] تم استخدام تكامل مجموعات بيانات RNA-Seq عبر الأنسجة المختلفة لتحسين شرح وظائف الجينات في الكائنات الحية المهمة تجاريًا (مثل الخيار) [155] أو الأنواع المهددة (مثل الكوالا). [156]

لا تعتمد القراءة التجميعية لـ RNA-Seq على جينوم مرجعي [121] ولذا فهي مثالية لدراسات التعبير الجيني للكائنات غير النموذجية ذات الموارد الجينية غير الموجودة أو ضعيفة التطور. على سبيل المثال ، تم إنشاء قاعدة بيانات SNPs المستخدمة في برامج تربية دوغلاس التنوب بواسطة من جديد تحليل النسخ في حالة عدم وجود تسلسل الجينوم. [157] وبالمثل ، تم تحديد الجينات التي تعمل في تطوير أنسجة القلب والعضلات والعصبية في الكركند من خلال مقارنة الترانسكريبتومات لأنواع الأنسجة المختلفة دون استخدام تسلسل الجينوم. [158] يمكن أيضًا استخدام RNA-Seq لتحديد مناطق ترميز البروتين غير المعروفة سابقًا في الجينومات المتسلسلة الموجودة.

على مدار الساعة الشيخوخة القائمة على النسخ تحرير

التدخلات الوقائية المتعلقة بالشيخوخة غير ممكنة بدون قياس سرعة الشيخوخة الشخصية. الطريقة الأكثر حداثة وتعقيدًا لقياس معدل الشيخوخة هي باستخدام المؤشرات الحيوية المختلفة لشيخوخة الإنسان ، والتي تعتمد على استخدام الشبكات العصبية العميقة التي يمكن تدريبها على أي نوع من البيانات البيولوجية omics للتنبؤ بعمر الموضوع. لقد ثبت أن الشيخوخة محرك قوي لتغييرات النسخ. [159] [160] عانت الساعات القديمة المستندة إلى النسخ النصية من تباين كبير في البيانات ودقة منخفضة نسبيًا. ومع ذلك ، فإن النهج الذي يستخدم التحجيم الزمني وثنائي الترانسكريبتومات لتحديد مجموعة الجينات التي تتنبأ بالعمر البيولوجي بدقة يسمح لها بالوصول إلى تقييم قريب من الحد النظري. [159]

تحرير RNA غير المشفر

يتم تطبيق Transcriptomics بشكل شائع على محتوى mRNA للخلية. ومع ذلك ، فإن نفس التقنيات قابلة للتطبيق بشكل متساوٍ على الحمض النووي الريبي غير المشفر (ncRNAs) التي لا تُترجم إلى بروتين ، ولكن بدلاً من ذلك لها وظائف مباشرة (على سبيل المثال ، الأدوار في ترجمة البروتين ، وتكرار الحمض النووي ، وربط الحمض النووي الريبي ، وتنظيم النسخ). [161] [162] [163] [164] تؤثر العديد من ncRNAs على حالات المرض ، بما في ذلك السرطان وأمراض القلب والأوعية الدموية والأمراض العصبية. [165]

تولد دراسات النسخ كميات كبيرة من البيانات التي لها تطبيقات محتملة تتجاوز بكثير الأهداف الأصلية للتجربة. على هذا النحو ، قد يتم إيداع البيانات الخام أو المعالجة في قواعد البيانات العامة لضمان فائدتها للمجتمع العلمي الأوسع. على سبيل المثال ، اعتبارًا من 2018 ، احتوت Gene Expression Omnibus على ملايين التجارب. [166]

قواعد البيانات النسخية
اسم مضيف البيانات وصف
أومنيبوس التعبير الجيني [99] NCBI ميكروأري RNA- تسلسل أول قاعدة بيانات transcriptomics لقبول البيانات من أي مصدر. تقديم معايير مجتمع MIAME و MINSEQE التي تحدد البيانات الوصفية اللازمة للتجربة لضمان التفسير الفعال والتكرار. [167] [168]
ArrayExpress [169] ENA ميكروأري يستورد مجموعات البيانات من Gene Expression Omnibus ويقبل عمليات الإرسال المباشرة. يتم تخزين البيانات المعالجة والبيانات الوصفية للتجربة في ArrayExpress ، بينما يتم الاحتفاظ بقراءات التسلسل الأولي في ENA. يتوافق مع معايير MIAME و MINSEQE. [167] [168]
أطلس التعبير [170] EBI ميكروأري RNA- تسلسل قاعدة بيانات التعبير الجيني الخاصة بالأنسجة للحيوانات والنباتات. يعرض التحليلات الثانوية والتصور ، مثل الإثراء الوظيفي لمصطلحات علم الجينات أو مجالات InterPro أو المسارات. روابط لبيانات وفرة البروتين عند توفرها.
جينيفستيجاتور [171] برعاية خاصة ميكروأري RNA- تسلسل يحتوي على تنظيمات يدوية لمجموعات بيانات النسخ العامة ، مع التركيز على البيانات الطبية والبيولوجية النباتية. يتم تطبيع التجارب الفردية عبر قاعدة البيانات الكاملة للسماح بمقارنة التعبير الجيني عبر تجارب متنوعة. تتطلب الوظائف الكاملة شراء ترخيص ، مع وصول مجاني إلى وظائف محدودة.
المرجع [172] DDBJ الجميع نسخ الإنسان والفأر والجرذان من 40 عضوًا مختلفًا. يتم تصور التعبير الجيني كخرائط حرارية معروضة على تمثيلات ثلاثية الأبعاد للهياكل التشريحية.
NONCODE [173] noncode.org RNA- تسلسل الحمض النووي الريبي غير المشفر (ncRNAs) باستثناء الحمض الريبي النووي الريبي والـ rRNA.

الأسطورة: NCBI - المركز الوطني لمعلومات التكنولوجيا الحيوية EBI - المعهد الأوروبي للمعلومات الحيوية DDBJ - بنك بيانات الحمض النووي الياباني ENA - أرشيف النيوكليوتيدات الأوروبي MIAME - الحد الأدنى من المعلومات حول تجربة المصفوفة الدقيقة MINSEQE - الحد الأدنى من المعلومات حول تجربة SEQuencing عالية الإنتاجية للنيوكليوتيدات.


مناقشة

TOMATOMICS هي قاعدة بيانات لا تجمع المعلومات الموجودة من قواعد البيانات الأخرى فحسب ، بل توفر أيضًا معلومات ذات قيمة مضافة تم إنشاؤها بواسطة جهود تحليل المعلومات الحيوية لدينا ، وتخدم كل هذه المعلومات من خلال وظائف الويب سهلة الاستخدام ، حيث يتم ربط المعلومات التي تم جمعها عضوياً عن طريق تحليل الخرائط وتحليلات التماثل ، مما يتيح إجراء عمليات بحث متقاطعة فعالة. تظهر المعلومات المرتبطة مُلخَّصة في الصفحة ومتصلة عبر ارتباطات تشعبية داخلية لسهولة التصفح. بالإضافة إلى الارتباطات الداخلية ، توفر TOMATOMICS العديد من الارتباطات التشعبية الخارجية لقواعد البيانات الأساسية ، لذلك يمكن استخدامها أيضًا كبوابة إلكترونية.

علاوة على ذلك ، تنبأت المعلومات المتعلقة بالشرح الهيكلي للجينات باستخدام بيانات RNA-seq العامة ، المسماة TMCS v1.2.1 ، المقدمة في TOMATOMICS. بالإضافة إلى التحسين على مستوى الجينوم في التنبؤ بـ UTRs ومتغيرات الربط ، يتضمن TMCS v1.2.1 تعليقًا توضيحيًا هيكليًا لـ 415 موقعًا جينيًا جديدًا. يصبح أحد هذه المواقع البالغ عددها 415 موقعًا TMCS01g1015680 مشروحًا على أنه "كربوكسيل استيراز 1" استنادًا إلى نتيجة بحث بلاست (الجدول التكميلي S2). هذا الجين مطابق بالفعل لجين carboxylesterase 1 الذي تم الإبلاغ عنه سابقًا ، المتورط في تفضيل الإنسان لنكهة الطماطم (Goulet et al. 2012). تم وضع تعليق توضيحي على TMCS05g1019480 و TMCS04g1023010 ، اللذين تم التنبؤ بهما أيضًا في هذه الدراسة ، على أنهما "أدينيلات شبيهة بنقل الأيزوبنتنيل" و "زيتين" ا-xylosyltransferase-like ، على التوالي (الجدول التكميلي S2). Adenylate isopentenyltransferase هو إنزيم رئيسي في التخليق الحيوي للسيتوكينين (Kakimoto 2001 ، Takei et al. 2001) ، و zeatin ا-xylosyltransferase الذي يعمل في استقلاب السيتوكينين (Turner et al. 1987 ، Dixon et al. 1989). السيتوكينينات ، وهي مجموعة من الهرمونات النباتية ، لها تأثير كبير على إنتاجية المحاصيل (أشيكاري وآخرون 2005 ، كوراكاوا وآخرون ، 2007 ، كودو وآخرون 2010). في الطماطم ، تلقي الدراسات الحديثة الضوء على التأثيرات الإيجابية للسيتوكينينات على الصفات الزراعية في ظل الظروف المالحة (Ghanem et al. 2011 ، Albacete et al. 2014 ، Aremu et al. 2014). تشير هذه الأمثلة إلى أن التنبؤ الجيني المستند إلى بيانات RNA-seq فعال في التقاط الجينات المهمة للبيولوجيا والهندسة الزراعية.

حتى الآن ، تم تناثر العديد من موارد المعلومات الجينية والجينومية داخل مجتمع بيولوجيا وتربية الطماطم. نعتقد أن TOMATOMICS تعمل كجسر لربط هذه الموارد المتعددة ، بما في ذلك موارد استنساخ Micro-Tom cDNA المتاحة من NBRP ، بطريقة متطورة وستلعب دورًا كمحور لبيولوجيا الطماطم omics في المستقبل.


تشريح جنين الفأر وعزل خلية واحدة

تم فصل الخلايا عن أنسجة وأعضاء أجنة الفئران E9.5 – E11.5 C57BL / 6 J. باختصار ، تم الحصول على أجنة الفئران E9.5 – E11.5 عن طريق القتل الرحيم للفئران الحامل ونقل الأجنة إلى طبق بتري يحتوي على محلول ملحي طازج ومعقم من Dulbecco (DPBS). تم غسل الأجنة على نطاق واسع لإزالة أي ملوثات للأمهات والدم الزائد. بعد ذلك ، تم وضع الأجنة في وسط Dulbecco المعدّل لـ Eagle (DMEM) الذي يحتوي على 10٪ من مصل الأبقار الجنيني (FBS). تضمنت الأنسجة والأعضاء المستخدمة في هذه الدراسة الدماغ الأمامي والدماغ المؤخر والجلد والقلب والكبد والأمعاء والرئة والجسيدات ، والتي تم فصلها بعناية باستخدام ملقط تشريح مجهري تحت مجهر تشريح. تم هضم هذه الأعضاء باستخدام 0.05 ٪ من حمض التربسين-إيثيلين أمينيتراسيتيك (EDTA) عند 37 درجة مئوية لمدة 5 دقائق تقريبًا ، ثم تمت إضافة DMEM (يحتوي على 10 ٪ FBS) لوقف الهضم. ثم تم فصل الخلايا إلى معلقات أحادية الخلية عن طريق الماصات اللطيفة باستخدام ماصة الفم.

التضخيم وحيدة الخلية (كدنا) وبناء المكتبة

تم إجراء تضخيم (كدنا) أحادي الخلية باستخدام بروتوكول STRT مع العديد من التعديلات للسماح بتعدد إرسال تسلسل الحمض النووي الريبي أحادي الخلية. باختصار ، بعد التربسين لكل عضو وأنسجة تم تشريحها للحصول على الخلايا المفردة ، تم استخدام ماصة الفم لاختيار خلايا مفردة في 2 ميكرولتر من محلول تحلل الخلية في أنابيب PCR سعة 200 ميكرولتر ، كل منها يحتوي على 0.1 U / ميكرولتر RNase Inhibitor (Takara ، 2313B) ، 0.0475٪ Triton X-100 (Sigma-Aldrich ، X100) ، 2.5 ميكرومتر من خليط ديوكسينوكليوتيد ثلاثي الفوسفات (dNTP) (Thermo ، R0193) و 2.5 ميكرومتر من النسخ العكسي للباركود (RT) الاشعال (TCAGACGTGTGCTTCCGATN-XXXXXXXX حيث تمثل X النيوكليوتيدات للرموز الشريطية الخاصة بالخلية المصممة وتمثل N المعرف الجزيئي الفريد [UMI] ، انظر الملف الإضافي 2). لتحليل الخلايا ، تم أولاً تحريك الأنبوب بشكل دوامي تمامًا ووضعه في جهاز تدوير حراري عند 72 درجة مئوية لمدة 3 دقائق لتحرير جزيئات الحمض النووي الريبي الخطية. بعد ذلك ، تم إخماد التفاعل فورًا على الجليد. بعد طرد التفاعل ، 2.85 ميكرولتر من خليط RT (40 U SuperScript II النسخ العكسي [Invitrogen ، 18،064،071] ، 5 U RNase Inhibitor ، 5 × Superscript II عازلة أول حبلا ، 25 ملي ديثيوثريتول [DTT] ، 5 م بيتين [سيغما] -ألدريش ، B0300] ، 30 ملي MgCl2 تمت إضافة [Sigma-Aldrich ، 63،020] ، و 1.75 ميكرومتر لقالب التبديل oligo [TSO] التمهيدي [AAGCAGTGGTATCAACGCAGAGTACATrGrG + G ، حيث يمثل rG riboguanosine one (+ G) ، و + G يشير إلى الجوانوزين المعدل LNA]) محللة الخلية. تم إجراء النسخ العكسي في جهاز التدوير الحراري عند 25 درجة مئوية لمدة 5 دقائق ، و 42 درجة مئوية لمدة 60 دقيقة ، و 50 درجة مئوية لمدة 30 دقيقة ، ثم 70 درجة مئوية لمدة 10 دقائق.

بعد النسخ العكسي ، 7.5 ميكرولتر من خليط PCR (6.25 ميكرولتر 2 × KAPA HiFi HotStart ReadyMix [KK2602] ، 300 نانومتر ISPCR oligo [AAGCAGTGGTATCAACGCAGAGT] ، و 1 ميكرومتر 3 تم إضافة القليل من التفاعل [GTGACTGGAGTTCAGACGTGTGAT]. تم تضخيم العينة بأربع دورات من 98 درجة مئوية لمدة 20 ثانية ، و 65 درجة مئوية لمدة 30 ثانية ، و 72 درجة مئوية لمدة 5 دقائق ، تليها 10-15 دورة من 98 درجة مئوية لمدة 20 ثانية ، و 67 درجة مئوية لمدة 15 ثانية. ، و 72 درجة مئوية لمدة 5 دقائق وأخيراً 72 درجة مئوية لمدة 5 دقائق.

تم تجميع العينات المكبرة ذات الرموز الشريطية المختلفة (حتى 96 رمزًا شريطيًا) معًا. تمت تنقية cDNAs المجمعة لأول مرة باستخدام DNA Clean & amp Concentrator-5 (DC2005 Vistech ، بكين ، الصين) وتم التصفية التتابعية في 50 ميكرولتر من H2O. بعد تنقية العينة مرتين باستخدام حبات 0.8 × Ampure XP (Beckman ، A63882) ، تم استخدام cDNAs في جولة ثانية من التضخيم باستخدام مؤشر التمهيدي الحيوي (/ Biotin / CAAGCAGAAGACGGCATACGAGATindexGTGACTGGAGTTCAGACGTGTGCTTCCG) من أجل ISSGTGTGCTTCCG إلى أربعة إضافية لـ ISS. دورات. في وقت لاحق ، تمت تنقية (كدنا) مرة أخرى باستخدام حبات 0.8 × Ampure XP. بعد ذلك ، تم تقطيع cDNAs إلى شظايا 300 نقطة أساس تقريبًا باستخدام Covaris sonicator. تم بعد ذلك إثراء cDNAs المجزأة التي تحتوي على الرمز الشريطي وتسلسل UMI باستخدام Dynabeads® MyOne ™ Streptavidin C1 (Invitrogen ، 65002).

تم إعداد المكتبات باستخدام KAPA Hyper Prep Kits (KK8505). تم استخدام محول NEB على شكل حرف U للربط. أخيرًا ، تم تضخيم الأجزاء المرتبطة بالمحول باستخدام أساس Illumina QP2 التمهيدي (CAAGCAGAAGACGGCATACGA) وبادئ عام قصير (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC) لمدة 8-10 دورات. تم تسلسل المكتبات على منصة Illumina Hiseq4000 لإنشاء قراءات نهائية مزدوجة بمقدار 150 نقطة أساس (متسلسلة بواسطة Novogene).

معالجة بيانات تسلسل الحمض النووي الريبي أحادية الخلية

قمنا أولاً بفصل القراءات الأولية على أساس المعلومات من الرموز الشريطية الخاصة بالخلية في قراءة 2 من قراءات النهاية المزدوجة. بعد ذلك ، تم قطع تسلسل TSO وتسلسل ذيل polyA في القراءة 1 بنصوص مخصصة. في وقت لاحق ، المتواليات في القراءة 1 التي لها قواعد منخفضة الجودة (ن & gt 10٪) أو التي كانت ملوثة بمحولات تم التخلص منها. تمت محاذاة تسلسل read 1 الذي تم تجريده مع الجينوم المرجعي للماوس mm10 (جامعة كاليفورنيا ، سانتا كروز ، UCSC) باستخدام TopHat (الإصدار 2.0.12) [39]. استخدمنا عدد htseq من حزمة HTSeq [40] لإحصاء القراءات المعينة بشكل فريد ، والتي تم تجميعها بعد ذلك على أساس الرموز الشريطية الخاصة بالخلية. لكل جين ، تمت إزالة النصوص المكررة مع UMIs متطابقة. أخيرًا ، لكل جين في كل خلية ، تم تحديد رقم نسخة النص على أساس عدد UMIs المتميزة لهذا الجين.

في المجموع ، قمنا بتسلسل 1916 خلية مفردة (انظر الملف الإضافي 3). تمت إزالة الخلايا التي تحتوي على أقل من 2000 من الجينات المكتشفة ، وترك 1819 خلية لتحليل المصب. نظرًا لأن معظم خلايانا المفردة لم تصل إلى مليون وحدة UMI ، فقد استخدمنا السجل2(TPM / 10 + 1) بدلاً من السجل2(TPM + 1) ، حيث يشير TPM إلى النصوص لكل مليون ، لتطبيع مستويات التعبير. منع هذا الإجراء عد كل نسخة عدة مرات.

تحليل تشبع البيانات المتسلسلة

للتأكد من أن عمق التسلسل لمجموعة البيانات الخاصة بنا كان كافيًا ، اخترنا عشوائيًا مجموعة واحدة من بيانات التسلسل (والتي تضمنت 64 خلية مأخوذة من الأمعاء E11.5) لتخفيض عينة بيانات التسلسل الخام إلى 10 ، 20 ، 30 ، 40 ، 50 و 60 و 70 و 80 و 90٪ من بياناتها الأصلية. بعد ذلك ، حصلنا على عدد الجينات المكتشفة في كل مجموعة من مجموعات بيانات أخذ العينات هذه وقارناها بأعداد الجينات المكتشفة في مجموعة البيانات الأصلية. تظهر النتائج في المربع المربع في الملف الإضافي 1: الشكل S1b.

الاختزال غير الخطي للأبعاد (t-SNE) والتكتل بناءً على مصفوفة التنظيم ومصفوفة التعبير

لاستكشاف العلاقات التطورية أو التنموية بين الأعضاء ، أجرينا تحليلًا جماعيًا غير خاضع للإشراف تم تعديله بواسطة خوارزمية الغابة العشوائية باستخدام مصفوفة التنظيم الثنائي ومصفوفة التعبير الجيني. تم إنشاء مصفوفة Regulon بواسطة SCENIC [23] باستخدام تعداد UMI. SCENIC هي خوارزمية يمكنها إعادة بناء شبكات تنظيم الجينات (GRNs) وتحديد حالات الخلية المستقرة من بيانات RNA-seq أحادية الخلية. لمزيد من التفاصيل ، قم بالوصول إلى موقع SCENIC: http://aertslab.org/#scenic. باختصار ، استنتجت SCENIC أولاً وحدات التعبير المشترك ، والتي تم قطعها لاحقًا بواسطة رابطة الدول المستقلة- تحليلات الحافز التنظيمي ، وترك مجموعة فرعية من الوحدات المشذبة تسمى Regulons. بعد ذلك ، سجل SCENIC جميع الخلايا لنشاط كل نظام عن طريق حساب إثراء النظام كمنطقة تحت منحنى الاسترداد (AUC) عبر ترتيب جميع الجينات في خلية معينة ، حيث تم تصنيف الجينات حسب قيم تعبيرها. أخيرًا ، تم الحصول على مصفوفة نشاط تنظيم ثنائي ، وباستخدام هذه المصفوفة ، أجرينا اختزالًا غير خطي للأبعاد (t-SNE) من خلال حزمة Rtsne في R.

بالنسبة لمصفوفة التعبير ، قمنا بتحليل بيانات الخلية المفردة لعام 1819 في شكل سجل2(TPM / 10 + 1) قيم التعبير باستخدام طريقة Seurat [41] (لمزيد من التفاصيل ، راجع http://satijalab.org/seurat/). على وجه التحديد ، تم اعتبار الجينات معبرًا عنها فقط إذا كان مستوى تعبيرها ≥ 1. تم تجاهل الجينات المعبر عنها في & lt 3 خلايا وخلايا تحتوي على 2000 جينة تم اكتشافها. تم استخدام الجينات شديدة التغير مع متوسط ​​التعبير & gt 1 والتشتت & gt 1 كمدخلات لتحليل t-SNE.

تم تعديل طريقة التجميع من Lake et al. [42] ، وتم إرفاق النصوص أيضًا في الملفات التكميلية لتلك الورقة. تجمع هذه الطريقة بين المجموعات غير الخاضعة للإشراف للكشف عن عدم التجانس في الأنواع الفرعية للخلايا والتصنيف الخاضع للإشراف لضبط المجموعات. في كل مرة ، تم الحصول على مجموعتين من خلال هذه الطريقة. باختصار ، (1) أجرينا أولًا تجميعًا هرميًا باستخدام مقاييس مسافة ارتباط بيرسون وحصلنا على أول مجموعتين منفصلتين. إذا كان الإدخال عبارة عن مصفوفة التعبير ، فقد تم تحديد الجينات شديدة التغير أولاً ثم قمنا بإجراء التجميع الهرمي. (2) استخدمنا بعد ذلك اختيار ميزة الغابة العشوائية بمقدار 10 أضعاف لاختيار جينات مميزة تقسم المجموعتين. (3) تم اختيار العينات ذات احتمالات التصويت الداخلية & gt 0.6 لكل فصل كمجموعة تدريب لتحقيق المصنف الأمثل ، والذي تم استخدامه للتنبؤ ببقية العينات. (4) أجرينا 100 مرة من 10 أضعاف التحقق من صحة الغابة العشوائية (CV) والعينات المهملة مع احتمالات التصويت الداخلية & lt 0.55. استخدمنا احتمالات التصويت الداخلي & gt 0.55 (أعلى من الافتراضي = 0.5) كقطع لتقليل الغموض في تصويت العينة. (5) للحصول على عناقيد أكثر دقة ، تكررت الخطوات من 1 إلى 4 بشكل متكرر على الفئات المشكلة حديثًا. طبقنا طريقة التصنيف على كل من مصفوفة التنظيم ومصفوفة التعبير. تم إنشاء أشجار التسلسل الهرمي في الشكل 1 ج والملف الإضافي 1: الشكل S1c بترتيب المجموعات التي تم الحصول عليها من خلال هذه الطريقة.

تحديد شروط TFs و DEGs و GO

لتحديد TFs ذات التصنيف الأعلى لمجموعة معينة ، قمنا بحساب متوسط ​​TFs لمصفوفة التنظيم الثنائي لهذه المجموعة والباقي. تم تحديد الترتيب من خلال الفرق بين متوسط ​​قيمة هذه المجموعة ومتوسط ​​قيمة الباقي. يقابل الفارق الأكبر مرتبة أعلى. بالنسبة لـ DEGs ، تم إجراء التحليل في Seurat. استخدمنا وظيفة Seurat find_all_markers (thresh.test = 1، test.use = “roc”) لتحديد جينات العلامة الفريدة الخاصة بالعنقود. بالنسبة إلى مجموعتين معينتين ، تم تحديد DEGs من خلال دالة find.markers مع المعلمات التالية: thresh.use = 1، test.use = “roc”. بالنسبة لجين معين ، أنتج اختبار roc قيمة تتراوح من 0 (لـ "عشوائي") إلى 1 (لـ "مثالي") ، تمثل "قوة التصنيف". تم اختيار الجينات ذات التغيير الطي 2 أو 0.5 وقوة ≥ 0.4. تم استخدام حزمة pheatmap في R لرسم خرائط الحرارة. تم إنشاء مؤامرات الكمان باستخدام Seurat. تم إجراء تحليل إثراء الشبكة باستخدام Metascape [24] (http://metascape.org/). يتم سرد TFs و DEGs المحددة في ملف إضافي 4.

بالنسبة للشكل 7 ، اخترنا جميع الصناديق التي تنظم واحدًا على الأقل من إبكام, همة, Cdh1, Cdh2، و الجبهة الوطنية 1، كما يستدل من تحليل سينيك. من بين هذه الصناديق ، Grhl2, Hnf1b، و Hnf4a تميل إلى لعب أدوار مهمة في تنظيم الخلايا الظهارية. ثم استخرجنا قائمة الجينات التي تم تنظيمها بواسطة هذه الصناديق لإجراء تحليل تخصيب الشبكة باستخدام Metascape ، يتم عرض أفضل 10 مصطلحات مخصبة في الشكل 7 ج.

تحليل الزمن الكاذب التنموي

استخدمنا حزمة Monocle2 [43 ، 44] في R لتحديد الأزمنة الكاذبة التنموية للأعضاء. بعد المصغر الأحادي ، استخدمنا بيانات حساب UMI كمدخلات وجينات مختارة ذات تشتت عالي (أكثر من ضعف التشتت المجهز) لترتيب الخلايا بدون إشراف. تم استخدام الإعدادات الافتراضية لجميع المعلمات الأخرى.

تحليل دورة الخلية وتحديد علامات السطح وعوامل النسخ

لإجراء تحليل دورة الخلية ، استخدمنا مجموعة جينات أساسية محددة مسبقًا ، بما في ذلك 43 جينة G1 / S و 54 G2 / M [45 ، 46]. تم حساب متوسط ​​التعبير عن كل مجموعة جينية على أنها النتيجة المقابلة. تم تحديد الخلايا ذات درجة G1 / S & lt 2 ودرجة G2 / M & lt 2 على أنها هادئة بخلاف ذلك ، فقد تم اعتبارها متكاثرة. بالإضافة إلى ذلك ، تم تعيين الخلايا التكاثرية مع درجة G2 / M ودرجة gt G1 / S G2 / M ، في حين تم تعيين الخلايا ذات درجة G1 / S و gt G2 / M بدرجة G1 / S. تم اختيار TFs من 1485 TFs المدرجة في AnimalTFDB 2.0 [47] ، وتم اختيار علامات السطح من 261 علامة سطح خلية تم جمعها في تقرير سابق [48].

خلية واحدة qRT-PCR

تم جمع خلايا مفردة إضافية من أنسجة الكبد E11.5 و E10.5. تم إجراء النسخ العكسي أحادي الخلية وتضخيم (كدنا) باتباع بروتوكول Smart-seq2. بعد الجولة الأولى من التنقية باستخدام 0.8 × حبات Ampure XP ، تم قياس كمية (كدنا) لكل خلية مفردة باستخدام qPCR من جين التدبير المنزلي (جابده) والجينات المختارة (للأسف 2, Slc4a1, Bcl11a1, سي دي 47، و سي دي 24 أ).

تألق مناعي

تم إصلاح الأعضاء أو الأجنة بنسبة 4٪ بارافورمالدهيد طوال الليل عند 4 درجات مئوية ثم تجفيفها بمحلول سكروز 20٪ طوال الليل عند 4 درجات مئوية. بعد ذلك ، تم دمجهم مع Tissue-Tek® O.C.T. مجمع (ساكورا # 4583). تم نفاذ المقاطع بسمك 6 ميكرومتر في Triton X-100 (0.5٪ في PBS) لمدة 30 دقيقة عند درجة حرارة الغرفة وحضنت في محلول منع (0.1٪ Triton X-100 و 10٪ من مصل الحمير في PBS) لمدة 90 دقيقة عند درجة حرارة الغرفة. تم تحضين المقاطع بأجسام مضادة أولية مخففة طوال الليل عند 4 درجات مئوية ثم بأجسام مضادة ثانوية مخففة (1: 400) عند درجة حرارة الغرفة لمدة ساعتين. أخيرًا ، تم غمر الأقسام في كاشف ProLong Gold المضاد للتلاشي مع 4 '، 6-Diamidino-2-phenylindole (DAPI ، Invitrogen # 1846939). تم الحصول على الصور باستخدام مجهر مسح ليزر متحد البؤر (Leica TCS SP8 ، Leica Microsystems ، Wetzlar ، ألمانيا). كانت الأجسام المضادة الأولية المستخدمة في هذه الدراسة هي الفئران المضادة لـ E-cadherin (تمييع Abcam # ab76055 ، 1:50) ، والأجسام المضادة المضادة للفيمنتين (Abcam # ab92547 ، وتمييع 1:50) ، والأجسام المضادة للفيبرونيكتين للأرنب (Abcam #). ab23750 ، تخفيف 1:50).


1 المقدمة

نظرًا لأن الزراعة تعتمد بشكل كبير على الغلاف الجوي السائد ، غالبًا ما تعاني نباتات المحاصيل من مختلف الضغوط البيئية أو اللاأحيائية بسبب تغير المناخ. هناك العديد من الضغوط اللاأحيائية ، بمعنى. الملوحة والجفاف والبرد والتشبع بالمياه وتقلبات درجات الحرارة ، مما يعيق بشكل كبير معدل النمو ويقلل من الغلة الزراعية على مستوى العالم. 1، 2 كما ذكرت وزارة الزراعة الأمريكية ومنظمة الأغذية والزراعة ، فإن الجفاف وإجهاد الملح هما عنصران محددان مهمان يؤثران على حوالي 26٪ و 20٪ من الأراضي الزراعية ، على التوالي (الاتحاد الجيوفيزيائي الأمريكي https://sites.agu.org). ملوحة التربة هي العامل الرئيسي الثاني المحدد للزراعة. يؤثر إجهاد الملح في الغالب على الأراضي الزراعية في المناطق القاحلة وشبه القاحلة في جميع أنحاء العالم. 3 النباتات في الظروف المسببة للجفاف تعيق في نهاية المطاف معدل النمو ، وتقلل من إنتاج المحاصيل ، وتشجع الآثار الضارة على العمليات الفسيولوجية ، والتمثيل الغذائي ، والكيمياء الحيوية للنبات. 2-4 علاوة على ذلك ، تم الإبلاغ أيضًا عن تأثير العديد من الضغوط اللاأحيائية الأخرى مثل التشبع بالمياه ، 5 ، 6 درجات الحرارة القصوى ، 7 وسمية المعادن / أشباه الفلزات على إنتاجية المحاصيل في محاصيل مختلفة ، بما في ذلك بذور اللفت. 8

napus براسيكا برز L. ، المعروف أيضًا باسم بذور اللفت أو الكانولا ، كمحصول مهم على مستوى العالم من خلال برامج تربية صارمة خلال العقود القليلة الماضية. من بين محاصيل البذور الزيتية ، تحتل بذور اللفت المرتبة الثانية في إنتاج البذور الزيتية في العالم بعد فول الصويا. تنتمي إلى عائلة الكرنب ، التي تضم 419 جنساً و 4130 نوعًا حول العالم. جينوم بذور اللفت هو 2 ن = 38 (AACC) ، والذي ينشأ من تهجين جينوم ب. oleracea و ب. رابا (الشكل 1 انظر المراجع 14 ، 15) تزرع بذور اللفت الآن بشكل أساسي في الصين وكندا وأوروبا كسبب لزيت الطعام وحصص الماشية والمشتقات الصناعية. 16 ، 17 محتوى زيت بذور اللفت حوالي 30.6-48.3٪ من الوزن الجاف. يتضمن ملف زيت بذور اللفت الأحماض الدهنية الحيوية مثل الأوليك (56.80-64.92٪) ، البالمتيك (4.18-5.01٪) ، أحماض اللينوليك (17.11-20.92٪). كمية α-tocopherol حوالي 13.22-40.01٪ من إجمالي محتويات الزيت. 18 بسبب تغير المناخ والتحضر والتصنيع ، أصبحت الضغوط اللاأحيائية التهديد الرئيسي لإنتاج المحاصيل. غالبًا ما تتعرض بذور اللفت ، جنبًا إلى جنب مع المحاصيل الرئيسية في جميع أنحاء العالم ، لضغوط لها تأثيرات كبيرة على الوظائف الفسيولوجية والكيميائية الحيوية والجزيئية للنباتات ، مما يؤثر في النهاية على نمو المحاصيل وإنتاجها. 8 تحسين تحمل الإجهاد اللاأحيائي لبذور اللفت هو نهج أساسي لزيادة إنتاج البذور الزيتية. 19 ، 20 موصوفة مسارات إشارات الإجهاد العامة في الشكل 2.

نشرت على الإنترنت:

الشكل 1. مثلث منهجي للتربية الخليطة بين ستة مهمين اقتصاديًا براسيكا الأنواع التي تتكون من ثلاثة ثنائيات ثنائية (خضراء) وثلاثة متآصلات (برتقالية) جنبًا إلى جنب مع حجم الجينوم المقدر. تشير الأحرف (ABC) داخل الأشكال البيضاوية إلى الرموز الجينومية. N تعني عدد الكروموسومات. تم إنشاء مثلث U وفقًا لـ Nagaharu (1935). تم استرجاع 9 حجم الجينوم من الحكام. 10-14

الشكل 1. مثلث منهجي للتربية الخليطة بين ستة مهمين اقتصاديًا براسيكا الأنواع التي تتكون من ثلاثة ثنائيات ثنائية (خضراء) وثلاثة متآصلات (برتقالية) جنبًا إلى جنب مع حجم الجينوم المقدر. تشير الأحرف (ABC) داخل الأشكال البيضاوية إلى الرموز الجينومية. N تعني عدد الكروموسومات. تم إنشاء مثلث U وفقًا لـ Nagaharu (1935). تم استرجاع 9 حجم الجينوم من الحكام. 10-14

نشرت على الإنترنت:

الشكل 2. مسارات إشارات الإجهاد اللاأحيائية العامة في النباتات ، بدءًا من إدراك الإشارة وتؤدي نحو استجابات الإجهاد. يؤدي الانتشار المبكر لاستشعار الإجهاد عبر المستقبلات / المستشعرات إلى تتابع استجابة الإجهاد في اتجاه مجرى النهر بواسطة ROS و CaM و phytohormones. يؤدي تمديد الإشارة ونقلها بواسطة الرسل الثانوي مثل PKs و PPs و MAPKs و CDPKs و CBLs و CIPKs إلى تنظيم تفاضلي لعوامل النسخ (TFs) والجينات المستجيبة للإجهاد. يؤدي تنظيم مثل هذه الـ TFs والجينات إلى تعديل الاستجابات الفسيولوجية والكيميائية الحيوية والجزيئية ، وبالتالي تحسين تحمل الإجهاد. مربعات على الجانب الأيسر ، تشير إلى الجينات الأساسية و TFs التي تعمل وتحمي النباتات في ظل الضغوط البيئية الشديدة. يظهر لون النص الأزرق والأحمر والأخضر في مربعات الجينات أن هذه الجينات أو TFs تعمل في ضغوط مختلفة. مقتبس ومعدّل قليلاً من رزا (2020 أ) ، 8 بإذن من Springer Nature

الشكل 2. مسارات إشارات الإجهاد اللاأحيائية العامة في النباتات ، بدءًا من إدراك الإشارة وتؤدي إلى استجابات الإجهاد. يؤدي الانتشار المبكر لاستشعار الإجهاد عبر المستقبلات / المستشعرات إلى تتابع استجابة الإجهاد في اتجاه مجرى النهر بواسطة ROS و CaM و phytohormones. يؤدي تمديد الإشارة ونقلها بواسطة الرسل الثانوي مثل PKs و PPs و MAPKs و CDPKs و CBLs و CIPKs إلى تنظيم تفاضلي لعوامل النسخ (TFs) والجينات المستجيبة للإجهاد. يؤدي تنظيم مثل هذه الـ TFs والجينات إلى تعديل الاستجابات الفسيولوجية والكيميائية الحيوية والجزيئية ، وبالتالي تحسين تحمل الإجهاد. مربعات على الجانب الأيسر ، تشير إلى الجينات الأساسية و TFs التي تعمل وتحمي النباتات في ظل الضغوط البيئية الشديدة. يظهر لون النص الأزرق والأحمر والأخضر في مربعات الجينات أن هذه الجينات أو TFs تعمل في ضغوط مختلفة. مقتبس ومعدّل قليلاً من رزا (2020 أ) ، 8 بإذن من Springer Nature

على مدى العقد الماضي ، أشارت العديد من التقارير إلى الاستنساخ والإفراط في التعبير عن الجينات في بذور اللفت مما يمكّن النباتات من تحمل العديد من الضغوط اللاأحيائية (الجدول 1). في وقت سابق ، بنناك 485 تم استنساخ الجين المرتبط بعائلة NAC ، وأظهرت النتائج ذلك بنناك 485 تم التعبير عنها بشكل كبير في الشتلات والنباتات البالغة من العمر 21 يومًا والتي كانت ناتجة عن الضغوط اللاأحيائية. 28 في دراسة أخرى ، الإفراط في التعبير عن BnNCED3 يزيد من تراكم حمض الأبسيسيك (ABA) ، وأكاسيد النيتريك (NO) ، وتوليد أنواع الأكسجين التفاعلية (ROS) في بذور اللفت المعدلة وراثيا. علاوة على ذلك ، أظهرت الخطوط المعدلة وراثيًا نموًا محدودًا للبذور ، وبدء الجذر الجانبي ، وتحسين شيخوخة الأوراق بوساطة ABA عن طريق تعديل تخليق ABA. 43 فحص الاستنساخ والتعبير بنيس 1 وكشف أن بنيس 1 يرتبط ارتباطًا وثيقًا بتحمل الإجهاد البارد ، خاصة في درجات الحرارة المنخفضة. أظهر التنظيم والتوصيف الجزيئي لعامل الارتباط المتكرر C (CBF) أن CBF مرتبط ارتباطًا وثيقًا بالإجهاد البارد. 44 في الآونة الأخيرة ، تحديد وتحليل التعبير عن بنباد 1 يزيد الملوحة وتحمل الإجهاد ، 37 وهكذا. يتم عرض أمثلة أخرى على الجينات المرتبطة بالإجهاد اللاأحيائي في بذور اللفت في الجدول 1.

نشرت على الإنترنت:

الجدول 1. نظرة عامة على الجينات اللاأحيائية المستجيبة للتوتر و / وعوامل النسخ لبذور اللفت جنبًا إلى جنب مع استجاباتها الرئيسية في ظل بيئة الإجهاد

تحسين براسيكا النيابة. لقد تم تناول تحمل الإجهاد اللاأحيائي منذ عدة عقود ، وتم استخدام العديد من الأدوات ، مثل تحديد المحاصيل ومعالجتها لتحمل الإجهاد اللاأحيائي ، وتطبيقات العديد من أدوات omics لتوضيح الجينات المرتبطة بتحمل الإجهاد اللاأحيائي. 45 ومع ذلك ، فإن الاكتشافات الرئيسية في هذا المجال هي اكتشاف الجينات استجابة للإجهاد المختلف ، وتطوير العلامات ، ورسم خرائط الجينات ، وتحليل النسخ ، وتنظيم الآليات الفسيولوجية والتركيبية الحيوية.

أدى تقدم أدوات omics مثل علم الجينوم وعلم النسخ وعلم البروتينات وعلم الأيض وعلم الظواهر إلى تحديث أبحاث البيولوجيا الجزيئية.سمح ذلك بفحص دقيق للوصلات بين الآلات الجزيئية لاستيعاب الجينات والبروتينات والعديد من المكونات التنظيمية الأساسية ، وتنظيم الاستراتيجيات الجزيئية المنهجية بشكل جماعي. 46 تسلسل الجينوم براسيكا سمحت المحاصيل بمزيد من الفهم لوراثة المحاصيل وفتحت طرقًا جديدة لتحسين المحاصيل. علاوة على ذلك ، فقد حولت الجينوميات الجزيئية والوظيفية في براسيكا أصناف. 47 تم تطوير أصناف مختلفة من بذور اللفت المعدلة وراثيا والتي تسمح بمزيد من التحمل مقارنة بالأصناف التقليدية. ساعد التقدم في الأساليب الناشئة لتحرير الجينوم (GE) مثل CRISPR / Cas9 في استكشاف آلية النباتات ضد استجابات الإجهاد. وصفت هذه المراجعة نهج omics المتكاملة التي يمكن أن تعزز إنتاج بذور اللفت بكفاءة لتلبية المتطلبات العالمية والإنتاج الزراعي المستدام.


قامت LG و WL و BL بوضع تصور للدراسة وتصميمها. قامت HyW و SL و XD و YY و YL و YG و XL و WW و HhW و XX بجمع البيانات وإجراء التحليلات. ساهم كل من HyW و SL و AR و PJ و LG في تفسير النتائج وصياغة المخطوطة. كل الكتاب قراءة وافقت على المخطوط النهائي.

تم دعم هذا العمل من قبل البرنامج الوطني للبحث والتطوير في الصين (2016YFD0600106) ، ومؤسسة البحث العلمي لكلية الدراسات العليا في جامعة فوجيان للزراعة والغابات (324-1122yb061) وصندوق الابتكار للعلوم & # x0026 Technology Project من Fujian Agriculture and جامعة الغابات (CXZX2020093A).


مصطلحات النسخة (omics): cDNAs و ESTs و RNA-seq وما إلى ذلك - علم الأحياء

مدعومة ببيانات RNA-Seq الخاصة بالضفيرة.

قد يقوم جين lncRNA المحتمل بتشفير عديد ببتيد صغير (ق).

مضاد المعنى: يتداخل مع CG3984 على الشريط المعاكس.

لم يتم شرح تقاطع (تقاطعات) إكسون RNA-Seq منخفض التردد.

تمت مراجعة النموذج الجيني خلال 5.56

انقر للحصول على قائمة بالميزات التنظيمية (المعززات ، TFBS ، إلخ) واضطرابات الجينات (الطفرات النقطية ، indels ، إلخ) داخل أو تداخل Dmel asRNA: CR45600 باستخدام ميزة مخطط أداة.

GBrowse - عرض مرئي لإشارات RNA-Seq

يرجى الملاحظة لم يعد FlyBase يشرف على عمليات استنساخ الجينوم ، لذا قد لا تكون هذه القائمة كاملة

يرجى الملاحظة يسرد هذا القسم cDNAs و ESTs التي تقع ضمن النطاق الجيني للنموذج الجيني ، والذي قد يشمل cDNAs و ESTs للجينات داخل الإنترونات ، أو الجينات المتداخلة. يرجى الاطلاع على GBrowse لمحاذاة cDNAs و ESTs مع نموذج الجينات.

لكل (كدنا) متسلسل بالكامل ، يحتفظ DGRC بأشكال مختلفة من (كدنا) (مثل الموسومة أو غير الموسومة) في عدة نواقل مضيفة مختلفة للاستنساخ اللاحق والتعبير في خطوط خلايا ذبابة الفاكهة و ذبابة الفاكهة.


الحقوق والأذونات

الوصول المفتوح تم ترخيص هذه المقالة بموجب ترخيص Creative Commons Attribution 4.0 International ، والذي يسمح بالاستخدام والمشاركة والتكييف والتوزيع والنسخ بأي وسيط أو تنسيق ، طالما أنك تمنح الائتمان المناسب للمؤلف (المؤلفين) الأصلي والمصدر ، رابط إلى ترخيص المشاع الإبداعي ، وبيان ما إذا تم إجراء تغييرات.

يتم تضمين الصور أو مواد الطرف الثالث الأخرى الواردة في هذه المقالة في ترخيص Creative Commons الخاص بالمقال ، ما لم يُذكر خلاف ذلك في حد الائتمان للمادة. إذا لم يتم تضمين المادة في ترخيص Creative Commons الخاص بالمقال وكان استخدامك المقصود غير مسموح به بموجب اللوائح القانونية أو يتجاوز الاستخدام المسموح به ، فستحتاج إلى الحصول على إذن مباشر من صاحب حقوق الطبع والنشر.


شاهد الفيديو: dna en rna (قد 2022).


تعليقات:

  1. Fenrizil

    ولا يحدث هكذا)))))

  2. Murtaugh

    سبق أن نوقش هذا مؤخرا.

  3. Moogujar

    رسالة مسلية جدا

  4. Meztizragore

    أعتذر ، لكني أعتقد أنك مخطئ. يمكنني إثبات ذلك. اكتب لي في PM.



اكتب رسالة