معلومة

الفرق بين الحمض النووي للأقمار الصناعية الكلاسيكية والأقمار الصناعية الدقيقة / الأقمار الصناعية الصغيرة

الفرق بين الحمض النووي للأقمار الصناعية الكلاسيكية والأقمار الصناعية الدقيقة / الأقمار الصناعية الصغيرة


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أنا جديد جدًا على هذا المجتمع ولدي سؤال أساسي حول تسلسل الحمض النووي المتكرر.

كيف يختلف الحمض النووي الساتلي (الكلاسيكي) عن السواتل المكروية / السواتل الصغيرة؟

تقدم جميع الكتب المدرسية أمثلة ملموسة عن الأقمار الصناعية الدقيقة و / أو الأقمار الصناعية الصغيرة مثل - (AC) 2 - أو - TACA (TAG) 3 - TACA ----.

هل يتشارك الحمض النووي للأقمار الصناعية الكلاسيكي في نفس الخصائص (مثالي ، غير كامل ، مركب ، معقد ، ثنائي نيوكليوتيدات ، ثلاثي نيوكليوتيدات ، إلخ) مثل STRs أو Minisatellites ولكن الاختلاف الوحيد هو أن DNA القمر الصناعي الكلاسيكي أطول؟


وكلاء Subviral

أسهم بواسطة ، . آر بي ويكنر ، في تصنيف الفيروسات ، 2005

قائمة الأعضاء

Ageratum enation virus Satellite DNA β

الحمض النووي الساتلي لفيروس الوريد الأصفر Ageratum β

Bhendi أصفر الوريد الفسيفساء الساتلي فيروس DNA β

الحمض النووي لفيروس تجعد أوراق الفلفل الحار β

تجعيد أوراق القطن الأقمار الصناعية لفيروس الأباد β

تجعيد أوراق القطن DNA القمر الصناعي لفيروس الجزيرة β

تجعيد أوراق القطن DNA القمر الصناعي لفيروس كوخران β

تجعيد أوراق القطن DNA الأقمار الصناعية لفيروس مولتان β

تجعيد أوراق القطن الساتل لفيروس راجستان β

ساتل فيروس الوريد الأصفر DNA Eupatorium β

الحمض النووي DNA Hollyhock Leafle الفيروس الساتلي لفيروسات الحمض النووي β

الحمض النووي الساتلي لفيروس الوريد الأصفر زهر العسل β

الحمض النووي الساتلي لفيروس الوريد الأصفر Malvastrum β

دنا القمر الصناعي لفيروس الضفيرة الورقية للبابايا β

التبغ الساتلي لفيروس إطلاق النار المجعد β

الحمض النووي لفيروس تجعد أوراق الطماطم الساتلي β

تجعيد أوراق الطماطم الصفراء الحمض النووي لفيروس الصين β


الفرق بين الحمض النووي للأقمار الصناعية الكلاسيكي والسواتل الدقيقة / الأقمار الصناعية الصغيرة - علم الأحياء

عملية الطفرة: السواتل المكروية هي علامات جينية مفيدة لأنها تميل إلى أن تكون متعددة الأشكال بدرجة عالية. ليس من غير المألوف أن يكون لديك سواتل بشرية دقيقة تحتوي على 20 أو أكثر من الأليلات واختلاف الزيجوت (حإكسب = التنوع الجيني ، د) من> 0.85. لماذا هم متغيرون جدا؟ يبدو أن السبب هو أن طفراتهم تحدث بطريقة مختلفة تمامًا عن الطفرات النقطية "الكلاسيكية" (حيث يحدث استبدال نيوكليوتيد بآخر ، مثل استبدال G لـ C). تحدث عملية الطفرة في السواتل المكروية من خلال ما يُعرف باسم التضاعف الانزلاقي. إذا تصورنا وحدات التكرار (على سبيل المثال ، تكرار ثنائي النوكليوتيد AC) كخرز على سلسلة ، يمكننا أن نتخيل أنه أثناء النسخ المتماثل ، يمكن أن ينزلق خيطين في المواضع النسبية قليلاً ، لكن لا يزال بإمكاننا جعل السحاب ينزل إلى الخرز. يمكن بعد ذلك إطالة أو تقصير خصلة واحدة أو أخرى عن طريق إضافة أو استئصال النيوكليوتيدات. وستكون النتيجة "طفرة" جديدة تشتمل على وحدة متكررة أطول أو أقصر من حبة واحدة. فكرة أن إضافة أو طرح تكرار واحد أسهل على الأرجح من إضافة أو طرح خرزتين أو أكثر هي الأساس لاستخدام نموذج الطفرة المتدرجة (SMM) على عكس نموذج الأليلات اللانهائي (انا). ميزة SMM (على الأقل من الناحية النظرية) هي أن الاختلاف في الحجم ينقل بعد ذلك معلومات إضافية حول نسالة الأليلات. تحت IAM ، الدولتان الوحيدتان "متماثلتان" و "مختلفتان". تحت SMM لدينا سلسلة متصلة محتملة من أوجه التشابه المختلفة (نفس الحجم ، متشابه في الحجم ، مختلف جدًا في الحجم). ومع ذلك ، إذا لم يتم استخدام SMM ، فقد يكون من الأسوأ استخدامه - قد يكون في الواقع مضللًا للغاية. حتى لو كانت عملية الطفرة الأساسية متدرجة إلى حد كبير ، فليس من الصعب رؤية كيف يمكن للانجراف أن يؤثر على توزيع أحجام الأليل بطريقة من شأنها إبطال SMM بالكامل تقريبًا (تصور ذلك من خلال فحص الشكلين 6.1 و 6.2 في المحاضرة 6).

    مكان محدد (على عكس العلامات متعددة المواضع مثل الأقمار الصناعية الصغيرة أو RAPDs)
    كودومينانت (يمكن تمييز الزيجوت متغايرة الزيجوت عن الزيجوت المتماثلة الزيجوت ، على عكس RAPDs و AFLPs التي هي & qutbinary ، 0/1 & quot)
    PCR القائم (يعني أننا نحتاج فقط إلى كميات ضئيلة من الأنسجة تعمل على الحمض النووي "القديم" أو المتحلل للغاية)
    جدا متعدد الأشكال ("متغير مفرط") - يوفر نمطًا كبيرًا
    مفيد في مجموعة من المقاييس من الهوية الفردية إلى الأنساب الدقيقة

1) استخراج الحمض النووي من الأنسجة (مجموعة متنوعة من الطرق الممكنة حسب نوع الأنسجة)

2) شظية الجينوم. قطع الحمض النووي لدينا إلى أجزاء ذات حجم مناسب باستخدام أنزيمات التقييد. بشكل عام ، فإن الإنزيمات التقييدية التي تنتج أحجام شظايا متوسطة في حدود 300-600 نقطة أساس هي الهدف المنشود.

3) إدراج. أدخل الأجزاء في البلازميدات. تسمح هذه الخطوة باستنساخ الشظايا - إنتاج نسخ عديدة من القطع 300-600 بي بي التي أدخلناها في البلازميدات. للحصول على فكرة أكثر تفصيلاً قليلاً عن كيفية عمل البلازميدات نواقل الاستنساخ، ابحث عن المصطلحات ذات الخط الغامق في صفحة مسرد المصطلحات. PUC19 هو بلازميد شائع الاستخدام لهذا النوع من التحليل. لماذا PUC19؟ ال مواقع التقييد في PUC19 معروفة (بحيث يمكن قطع شظايا الحمض النووي المربوطة لاحقًا) وهي يتكرر بشكل جيد في ثقافة بكتيرية.

4) طبق البلازميدات على غشاء من النايلون.

5) مسبار الغشاء الذي يحتوي على قليل النوكليوتيدات المسمى للتكرارات المرغوبة (على سبيل المثال ، AC10).

6) حضاره المستنسخات الموجبة (شظايا البلازميد التي ترتبط بمسبارات القلة).

7) يقطع إدخال من البلازميدات مع إنزيمات تقييد وتشغيلها على هلام الاغاروز.

    أ) ل تحقق وجود تكرار و
    ب) للسماح لنا بذلك تقدير الحجم من الإدراج.
    أ) "التوافق" بين البادئين (لا يمكن أن يكونا مكملين لأن ذلك قد يتسبب في ارتباط متقاطع ، يجب أن يكون لهما أطوال ودرجات حرارة انصهار متشابهة جدًا) ،
    ب) تجنب رموز التوقف أو التسلسلات الأخرى التي قد تسبب فشل PCR ،
    ج) تجنب مواقع بدء التمهيدي التي لا ترتبط جيدًا ، وتجنب المتواليات المتناظرة (التسلسلات التي لها نفس التسلسل من أي من الطرفين) وعدد آخر.
    د) إجمالي أطوال المنتجات المضخمة من 100-250 نقطة أساس ، بحيث تكون مجدية لتسلسل المواد الهلامية أو التنميط الجيني الآلي الذي سنستخدمه للتصور.
    ه) تجنب التكرارات قرب نهاية المنطقة المتسلسلة. قد تحتوي بعض النسخ الموجبة التي قمنا بتسلسلها على وحدات تكرار جيدة ، ولكنها قريبة جدًا من نهاية التسلسل. ثم نفتقر بعد ذلك إلى منطقة مجاورة كافية لتصميم برايمر. وهذا ، جزئيًا ، هو سبب رغبتنا في الحصول على أجزاء من 300-600 نقطة أساس - قصيرة بما يكفي لتكون قابلة للتسلسل ، ولكنها طويلة بما يكفي لتقليل احتمالية أن يكون التكرار "شماعة منحدرة".

11) ترتيب البادئات الخاصة بالموضع (بشكل عام ستكون 20-30 قسماً قسماً للمناطق المرافقة غير المجاورة مباشرة لوحدة التكرار).

فيما يلي مثال على تسلسل الأقمار الصناعية الصغيرة لـ scrub-jays الذي يحتوي على وحدة تكرار ومواقع التمهيدي الأمامية والعكسية.
SJR3 [FSJ]
GCCAAGCTTGCATGCCTGCAGGTCGACTCT AGAGGATCCCCAAGTGTATGT GCATACACGTG
كاكاكاكاكاكاكاكاكا جاجتجتجكاكاتجتجكاتجكاكاكتكاجاجاكاجتج
كتاجتااجتكتك أجكاككاتكتجكاجكاكاج جتكتجكاكااككاتكككاكتجا
تجتكككاكاجتجاكتجت

من بداية التمهيدي الأمامي إلى نهاية التمهيدي العكسي ، ما سبق هو 131 نقطة أساس. التكرار هو CA11
ال يتم تمييز وحدة التكرار باللون الأحمر ، بينما ال إلى الأمام و يعكس p r i m e r s يتم تمييزها في أزرق و لون أخضر . سنرسل طلبًا لتسلسلات التمهيدي (في حالتنا نضيف 19 نقطة أساس إضافية م13 ذيل ، والذي يسمح لنا بإرفاق نيوكليوتيدات الفلورسنت / dNTPs بمنتجنا المضخم في PCR). ثم يكتشف الليزر الموجود في جهاز التسلسل / آلة التشكيل الجيني الآلي لدينا التألق ، وهذا هو ما نقوم به تصور النطاقات التي تشكل البيانات الأليلية التي نأمل في جمعها وتحليلها.

1) استخرج الحمض النووي. غالبًا ما يبدأ المرء بتفكيك الأنسجة بطريقة ما (على سبيل المثال ، عن طريق طحن النيتروجين السائل). تشمل بدائل عملية الاستخلاص مستخلصات الفينول والكلوروفورم الكلاسيكية ، والاستخلاصات القائمة على الملح ، ومجموعة متنوعة من الأدوات التجارية. نتخلص من البروتينات ومكونات الأنسجة الأخرى غير DNA في هذه الخطوة. قد يشمل التحليل النموذجي استخراج الحمض النووي من كل فرد في مجموعة سكانية محلية تتكون من 30 فردًا.

2) يضخم، يوسع، يبالغ. نضيف كمية صغيرة جدًا من كل عينة من 30 عينة من الحمض النووي المستخرج إلى كوكتيل PCR للتضخيم في جهاز التدوير الحراري. هذه خطوة "سحرية" أحدثت ثورة في البيولوجيا الجزيئية. نبدأ بدون حمض نووي تقريبًا وننتهي بما يكفي يمكننا رؤيته على مادة هلامية! توجد العديد من وصفات "الكوكتيل" - فهي تحتوي عادةً على الإنزيم البكتيري المحب للحرارة طق بوليميراز (أساسي) ، ومزيج dNTP (نيوكليوتيدات ستسمح بالتكاثر الهائل للحمض النووي المستهدف) ، وكلوريد المغنيسيوم ، و dNTPs المسمى بالفلوريسنت (هذه سوف ترتبط بذيل M13 أو T3 المضاف خصيصًا وتضيء تحت الليزر وتصنع العصابات من أليلات الحمض النووي تظهر على الهلام).

3) حمل. نقوم بتحميل 30 منتجًا مضخمًا في ممرات منفصلة في هلام بولي أكريلاميد عمودي كبير. نقوم أيضًا بتحميل عدة ممرات بحمض نووي سلم - شظايا معروفة الحجم من الحمض النووي المكبر بكمية / تركيز معروف. السلم الشائع هو قطع لامدا فج باستخدام إنزيمات مقيدة لإنتاج سلسلة من الشظايا. لا تستخدم أجهزة التسلسل الشعرية الأحدث مادة هلامية.

4) قم بتشغيل جهاز التسلسل. نقوم بتشغيل المنتج المضخم من خلال جهاز التسلسل حتى يتم تشغيل جميع الأليلات بواسطة الليزر ، الذي يضيء النيوكليوتيدات الفلورية ويجعل العصابات تضيء على الجل (أو الانتقال الرقمي المباشر إلى الكمبيوتر). ينشئ جهاز التسلسل كلاً من الصورة التناظرية (لأجهزة التسلسل القديمة القائمة على الهلام) والبيانات المخزنة رقميًا المتعلقة بحجم الأجزاء.

5) تحسين (الاختلافات في الخطوات 2-4). غالبًا ما يتطلب الأمر قدرًا كبيرًا من العبث للحصول على شروط تفاعل البوليميراز المتسلسل (PCR) المناسبة لمزيج معين من مادة التمهيدي ، والحمض النووي ، والمُدرِّج الحراري ، والمُسلسِل. تشمل المتغيرات الرئيسية في التحسين ما يلي:
درجة الحرارة (تسلسل التمهيدي سيكون له درجة حرارة انصهار متوقعة ولكن ما يعمل بالفعل قد يكون أعلى أو أقل) ،
الأوقات المبرمجة بواسطة PCR للتحريف والصلب وتمديد الخطوات
تركيزات كلوريد المغنيسيوم

تشمل الطرق البديلة للتصور المواد الهلامية المتسلسلة المصنوعة يدويًا من البولي أكريلاميد مع تلطيخ الفضة أو تلطيخ CyberGreen أو تلطيخ بروميد الإيثيديوم أو وضع العلامات المشعة. العديد من هذه المواد تحتوي على مواد كيميائية سيئة (EtBr) أو النشاط الإشعاعي ، لذلك نشعر بأننا محظوظون لاستخدام إجراء نظيف وآمن نسبيًا.

الشكل 8.1. رسم تخطيطي منمق للهلام الكهربي للسواتل المكروية. تيار يسحب الحمض النووي المتضخم إلى أسفل
"ممرات" في هلام بولي أكريلاميد. يمكن بعد ذلك فصل الأجزاء بالحجم (bp = أزواج القاعدة) والأفراد
يمكن التنميط الجيني لتكوينها الأليلي (متجانسة الزيجوت أو الزيجوت المتغاير لأليل واحد أو أكثر). هنا
يحتوي الممر الأيسر على "سلم" من الأجزاء المعروفة الحجم ، بينما يحتوي الممر الثاني على الحمض النووي من فرد واحد
(الطراز العرقى قبل الميلاد) والممر الثالث يحتوي على الحمض النووي من فرد ثان (التركيب الوراثي ميلادي). تشغيل مواقع متعددة
يوفر ثروة من المعلومات الجينية حول الأفراد أو السكان أو الأنواع.

E. كيف نقوم بتحليل المعلومات الأليلية؟ للحصول على وصف أكثر تفصيلاً قليلاً ، انتقل إلى صفحة التحليل الجيني.
يمكنك أيضًا تنزيل مستند Word الخاص بي على برنامج Web Genetic. يقدم Luikart and England (1999) نظرة عامة (أقدم) على المناهج. لاستخدام علامات بديلة ، انظر الأوراق (معظمها من TREE) بواسطة Sunnucks (2000) ، Mueller and Wolfenbarger (1999 AFLP) ، Campbell et al. (2003 AFLP) وبرومفيلد وآخرون. (2003 SNPs - تعدد أشكال النوكليوتيدات المفردة).

    1) أدوات وراثية السكان التقليدية
      تغاير الزيجوت (حObs, حإكسب = د)
      توازن هاردي واينبرغ
      الربط اختلال التوازن
      Fشارع وغيرها F-الإحصاء
      المسافات الجينية (وتر كافالي سفورزا ، مسافات نيوس 1972 و 1978)
      تقديرات 4نه م و 4نهم. (م للطفرة ، م للهجرة)

    2) تدابير خاصة بالأقمار الصناعية الدقيقة (تعتمد في الغالب على SMM ونماذج الطفرات التدريجية)

    (دلتا مو تربيع) من Goldstein et al. 1995
    DSW من Shriver وآخرون. (1995)
    صشارع من Slatkin (1995) كما تم تنفيذه بواسطة Goodman (1997)
    ميشالاكيس وإكسكوفير (1996)


    السواتل الدقيقة والكتابة VNTR في البيئات السريرية

    للحصول على نسخة قابلة للطباعة من اختبار May CE ، انتقل إلى هنا أو لإجراء الاختبار عبر الإنترنت ، انتقل هنا. لمزيد من المعلومات ، قم بزيارة علامة التبويب التعليم المستمر.

    عند الانتهاء من هذه المقالة ، سيتمكن القارئ من:

    1. استذكر البيولوجيا الشاملة للسواتل المكروية والأحداث التي تحدث والتي تؤدي إلى التنوع العشوائي للواسمات الجينية.

    2. ناقش التقنية المتضمنة في تقييم مواقع VNTR.

    3. وصف التطبيقات السريرية التي تستخدم فيها طباعة VNTR.

    4. ناقش فوائد كتابة VNTR.

    يتمثل أحد تطبيقات التكنولوجيا الجزيئية في ما يشار إليه بالعامية باسم "بصمة الحمض النووي" أو "تحديد سمات الحمض النووي". يعتبر تشبيه بصمات الأصابع مناسبًا ، حيث أن الطريقة تولد نمطًا بيولوجيًا قابلًا للتكرار يكون فريدًا للفرد ولكنه يوفر معلومات قليلة أو معدومة عن النمط الظاهري حول المصدر (الجنس هو الاستثناء المشترك الوحيد ، كما هو مفصل أدناه). توفر الطريقة أيضًا البيانات التي يمكن استخدامها لحساب الارتباط بين العينات. بالإضافة إلى مظهرها الشائع في إعدادات الطب الشرعي الإجرامية الخيالية (والحقيقية) ، فإن القدرة على ربط شظايا تتبع محددة من الأنسجة البشرية بالأفراد وتحديد العلاقة بشكل موضوعي بين العينات ذات فائدة حقيقية في الدراسات الأنثروبولوجية و- أكثر لتركيزنا- البيئات السريرية العادية . تُعرف الطريقة الأكثر شيوعًا لتوصيف الحمض النووي باسم الكتابة التكرارية المتغيرة للنيوكليوتيدات الترادفية (VNTR) وستكون محور تركيزنا الحالي.

    المصطلح

    أولا ، بعض المصطلحات. داخل الكروموسومات التي تشتمل على الحمض النووي لمعظم الكائنات الحية بما في ذلك البشر ، غالبًا ما توجد مناطق غير مشفرة بين الجينات تتكون من ترادفات متعددة (من الرأس إلى الذيل) متكررة واحدة قصيرة (الأكثر شيوعًا 2 أو 3 أو 4 أو 5 قاعدة). قد تكون الأمثلة (ATT) n أو (GTTAC) n ، حيث تتكرر المجموعة الأبوية من النيوكليوتيدات في صف n مرة. يشار إلى هذه العناصر باسم السواتل المكروية. الاسم مشتق من العصور المظلمة للبيولوجيا الجزيئية عندما اشتمل العزل التحضيري للحمض النووي على تنبذ فائق الكثافة على تدرجات CsCl. نظرًا لتكوينها الموحد ، فإن شظايا الحمض النووي المنفصمة من الحمض النووي للأقمار الصناعية الدقيقة تشكل نطاقات صغيرة ومتميزة منفصلة قليلاً عن مادة الحمض النووي غير المتكررة. عندما يتجاوز عدد العناصر المكررة (n) حوالي 50 ، يتم تشكيل نطاقات فريدة متشابهة ولكنها أكبر قليلاً ، وتسمى هذه العناصر الأطول ذات البنية المتشابهة minisatellites. لإبقاء الأمور معقدة بلا داعٍ ، يطلق على السواتل المكروية أحيانًا اسم التكرارات الترادفية القصيرة (STRs) أو التكرارات البسيطة المتسلسلة (SSRs) ، على الرغم من أن هذا المصطلح الأخير يتم تطبيقه بشكل متكرر في علم الوراثة النباتية. أخيرًا ، يُشار إلى كل من السواتل الدقيقة (بأي اسم) والأقمار الصناعية الصغيرة مجتمعة باسم VNTRs. من الناحية العملية ، غالبًا ما يتم استخدام مصطلحات كتابة STR ، وكتابة الأقمار الصناعية الصغيرة ، وكتابة VNTR بشكل متبادل - وهو عدم وجود مصطلحات يمكن أن يؤدي في بعض الأحيان إلى الارتباك حيث يبحث الناس عن الاختلافات في المعنى غير المقصود.

    مادة الاحياء

    إذا كان هناك ما يكفي منها لرؤية نطاقات مميزة على تدرجات CsCl ، فلا عجب في وجود العديد من السواتل الميكروية في الجينوم البشري. بشكل عام ، فهي تشكل حوالي ثلاثة بالمائة من إجمالي الجينوم النووي البشري ، منتشرة بشكل أو بآخر بشكل موحد عبر جميع الكروموسومات. العناصر التي تستند إلى عناصر العدد الفردي (ثلاثة أو خمسة نيوكليوتيدات) هي تقريبًا نصف شيوع العناصر التي تحتوي على عناصر عدد زوجي (اثنان أو أربعة أو ستة نيوكليوتيدات) ولسبب غير معروف - أو إذا كان هناك سبب - فإن SSRs الثلاثية هي الأكثر شيوعًا بالاشتراك مع مناطق الترميز. من غير الواضح ما إذا كانت السواتل المكروية لها وظيفة بيولوجية مفيدة متسقة ، وفي معظم الحالات إما أنها تبدو وكأنها لا تفعل شيئًا أو أنها مسببة للأمراض. الأمثلة المسببة للأمراض المتعلقة بتكرارات ثلاثي النوكليوتيدات لها اسم جماعي خاص بها مثل اضطرابات تكرار ثلاثي النوكليوتيدات. ومن أشهر الأمثلة على ذلك مرض هنتنغتون. في هذه الحالة ، يحدث عنصر التكرار CAG داخل جزء خارجي (ترميز البروتين) من جين HTT مع كل ترميز متكرر لبقايا جلوتامين إضافية في سلسلة في بروتين هنتنغتين الناضج. عند n 40 ، لوحظ الاختراق الكامل (أسوأ عرض للحالة) وخطر انتقال المرض إلى الأبناء بنسبة 50٪.

    بالنسبة لاعتباراتنا الحالية ، ما هو مهم هنا هو أن الأرقام المتكررة (n) لموقع ساتل صغير واحد يمكن أن تتغير أحيانًا بين الأجيال. تُعرف إحدى الآليات التي يحدث بها ذلك باسم انزلاق البوليميراز. بشكل أساسي ، يحدث هذا أثناء تكرار الحمض النووي إذا توقف نشاط البوليميراز مؤقتًا وانفصل الخيط الناشئ لفترة وجيزة عن القالب قبل إعادة ربطه ، فقد يصلب في السجل فيما يتعلق بالعنصر المتكرر إما في المنبع أو في اتجاه مجرى النهر حيث تم فصله. نظرًا لأن نشاط البوليميراز يستأنف الآن ، فقد اكتسب حبلا النسل أو فقد أرقام النسخ من التكرار ، على التوالي. لوحظ أن كسب التكرارات يحدث بشكل متكرر أكثر من الخسارة. بالنظر إلى هذه الآلية ، من المنطقي أيضًا أنه كلما زاد طول القمر الصناعي الصغير ، زادت فرص حدوث انزلاق أثناء النسخ المتماثل. بشكل عام ، هناك اتجاه نحو الحصول على وقت أطول بمرور الوقت ، وزيادة درجة عدم الاستقرار كلما تطول ، مما يؤدي في الواقع إلى إنشاء عملية ردود فعل إيجابية. هذا لا يصبح عملية متسارعة على المقاييس الزمنية التطورية ويجب أن يتم تقييدها بفقدان لياقة الكائن الحي لأن المزيد والمزيد من المناطق الصبغية تصبح عمليات تكرار قصيرة لا نهاية لها.

    هناك آلية أخرى يمكن أن تؤدي إلى تغييرات في عدد تكرار عنصر الأقمار الصناعية الصغيرة والميكرو ساتلية وهي العبور غير المتكافئ. يتم تذكير القراء أنه أثناء الانقسام الاختزالي ، يسمح كسر وإعادة انضمام أزواج الكروموسومات المتجانسة بإعادة تركيب الأليلات. تحدث هذه الكسور والوصلات على طول عناصر التسلسل المتجانسة على الكروموسومين ، ولكن كما في حالة انزلاق البوليميراز ، من الممكن حدوث تحول في السجل بواسطة بعض مضاعفات حجم العنصر المتكرر أثناء محاذاة الخيط. سيكون للكروموسومات الناتجة المعاد تجميعها واحدة اكتسبت تكرارات بينما فقدت الأخرى عددًا متساويًا. بشكل مشترك مع انزلاق البوليميراز ، من المرجح بشكل متزايد أن يحدث هذا النوع من عدم الاستقرار مع زيادة طول المنطقة - أي عدد التكرارات n -.

    من المهم أن تكون هناك آليات للتغيير في رقم النسخ المتكرر (يؤدي ذلك إلى إنشاء علامات قابلة للتفاضل بمرور الوقت) وأن هذه التغييرات نادرة جدًا بشكل فردي ، وتحدث على مقياس زمني تطوري (مما يعني أنه يمكننا أن نتوقع في جميع الحالات تقريبًا ، تظل أحجام الأليلات ثابتة بين أجيال). بشكل عام ، يتم تقديم مجموعة كبيرة ومتفرقة من VNTRs عبر الجينوم ، ويجب أن نتوقع منهم أن يتصرفوا بشكل ثابت في الحجم عند الانتقال من الوالدين إلى النسل. هذه العشوائية للتشتت عبر الجينوم ، والتنوع السكاني المرتفع نسبيًا لكل موضع ، والتردد المنخفض لمزيد من الاختلاف بين أجيال الكائن الحي تكمن وراء فائدتها كعلامات وراثية.

    تقنية

    من الناحية العملية ، يتم اختيار مواقع VNTR للتقييم بناءً على وجود تسلسلات مرافقة محفوظة للغاية عدد كبير من أحجام الأرقام المتكررة التي تمت رؤيتها عبر السكان المعنيين (بمعنى آخر ، التنوع الأليلي العالي) وسلوك التضخيم الجيد (التضخيم الموثوق للمكان الحقيقي عبر مجموعة واسعة من تركيزات المدخلات ، قلة أو عدم وجود منتجات تضخيم زائفة). لسهولة الاستخدام والراحة في أداء الاختبار ، من المرغوب فيه أيضًا تعدد الإرسال في تفاعلات تضخيم واحدة ، لذلك يتم تحديد المواقع ذات أحجام المنتجات غير المتشابهة (أي المنتجات غير المتداخلة) وحركية التضخيم المماثلة ومتطلبات التفاعل الشائعة لتجميعها معًا. لكل موضع VNTR فردي ، يتم اختيار بادئات PCR التي تفي بهذه المعايير ، ويتم تمييز دليل PCR واحد للزوج لكل موضع بشكل فلوري. نظرًا لأن طريقة الكشف النهائي ستدعم خمس قنوات صبغية قابلة للفصل ، يتوفر ما مجموعه أربعة أصباغ مستهدفة ، مما يعني أن المتطلبات المذكورة أعلاه للأمبليكونات ذات الحجم المختلف ليست مطلقة ، عندما تكون الأمبليكونات ذات الموقعين متداخلة الحجم ، فيمكن أن تكون متباينة صبغ المسمى. من خلال مزيج من أحجام المنتجات المتوقعة القابلة للتباين واستخدام الأصباغ المختلفة حيث قد تتداخل الأحجام ، من الممكن مضاعفة 15-20 موقعًا مختلفًا في تفاعل واحد. (من الناحية الفنية ، فإن التحديات في إجراء العديد من التفاعلات المتنافسة تتضخم بكفاءة شبه متساوية قد تجعل من الأسهل تقييد تفاعلات تفاعل البوليميراز المتسلسل الفردية إلى أربعة إلى ستة مواضع لكل مجموعة تعدد الإرسال ، ثم دمج نواتج العديد من هذه التفاعلات لخطوة الاكتشاف.)

    بالنظر للحظة واحدة فقط من مواقعنا ، إذا قمنا بتضخيمه في كائن ثنائي الصبغيات مثل الإنسان ، نتوقع منتجات من أليلين - واحد على كل زوج كروموسوم مضيف. بالنسبة لكل موقع ، نتوقع ألا نحصل على أي أمبليكون (في حالة حذف الموقع) ، أو منتج بحجم يتم تحديده من خلال عدد عناصر التكرار الموجودة في القمر الصناعي الصغير. إذا أخذنا تكرار ثلاثي الصيغة الصبغية كمثال وافترضنا بعض المساحة للتسلسلات المرافقة حيث توجد بادئات PCR الخاصة بنا ، فقد نواجه عينة سكانية في هذا الموضع ، نرى أحجام amplicon من 112 إلى 130 نيوكليوتيد في الطول على فترات 3 nt. سيحدث كل من هذه الأحجام المنفصلة عند بعض التردد في السكان. إذا قمنا بتوسيع هذا إلى الحالة ثنائية الصبغيات ، فإننا نتوقع ألا نرى أي أمبليكون (تم حذف موضع متماثل الزيجوت ، كلاهما الأليلين) منتج بحجم واحد (حيث يحدث أن كلا الأليلين متماثلان لنفس رقم التكرار) أو منتجين (حيث تكون الأليلات متغايرة الزيجوت من أجل عدد التكرار). على أي حال ، يمكنك إما تسجيل أي منتج أو منتج واحد أو اثنين وستكون المنتجات في حال وجودها بأحجام معروفة ومحددة مسبقًا.

    هناك فارق بسيط شائع في المنهجية وهو إضافة خطوة تمديد PCR نهائية أطول والتي تسمح بتوحيد أحادي أحادي لجميع المنتجات (يميل بوليميريز الحمض النووي المستخدم بشكل شائع في هذا التطبيق إلى إضافة واحد "أ" إلى 3 نهايات أمبليكون) . إذا لم يُسمح لهذا بأن يكتمل ، فإن المنتج النهائي عبارة عن مزيج من المنتجات غير الحادة والأخرى أحادية التحميل ، مما يؤدي إلى ظهور نطاقي منتجات على حدة. يشجع الامتداد النهائي الأطول جميع المنتجات على أن تكون أحادية التحميل وبالتالي تولد ذروة موحدة واحدة - فكرة لطيفة ولكنها في الواقع تتأثر أيضًا بالتسلسلات المجاورة ، مما يعني أن مواقع VNTR الفردية تميل إلى أن يكون لها "شخصيات" مميزة كما يتضح من النسب المميزة لـ هاتين القمتين ، أو في بعض الأحيان سلسلة تنازلية من منتجات "التلعثم" - دليل على انزلاق الحمض النووي في الموضع أثناء تفاعل البوليميراز المتسلسل.

    من منظور الأجهزة ، يمكننا استخدام الرحلان الكهربائي الشعري (متوفر بشكل ملائم في شكل آلات Sanger القديمة المضمونة للتسلسل) لفصل هذه المنتجات بشكل موثوق حسب الحجم واللون ، مع دقة تحديد الحجم بمساعدة التضمين على قناة صبغ مخصصة بمعيار الحجم في كل منها تفاعل.

    الآن إذا قمنا بتوسيع هذا إلى عدد من هذه المواقع وتمكنا من تحديد المنتج (المنتجات) من كل منها عن طريق مزيج من ملصق الصبغة و / أو الحجم ، فيمكننا إنشاء عدد كبير من التركيبات الممكنة لحجم المنتج وأنماط الألوان - كل منها قابل للتكرار تم إنشاؤها بواسطة قالب DNA لفرد واحد. مع وجود عدد كافٍ من هذه المواقع مجتمعة ، لا تكون النتائج قابلة للتكرار لكل فرد فحسب ، بل هي أيضًا فريدة (أو تقترب من كونها فريدة من نوعها ، بالنسبة لبعض الاحتمالات الفلكية العالية) لهذا الفرد. مع المواقع المستخدمة بشكل شائع لكتابة VNTR البشري ، هناك حاجة فقط إلى 12-15 علامة للوصول إلى مستويات مقبولة من "التفرد".

    ترجمة

    تحدث مرحلتان على الأقل من تفسير البيانات. الأول هو الفحص المباشر لبيانات الرحلان الكهربائي الشعري للعلامات المتوقعة ، و "binning" البيانات. كما نفهم الآن ، يمكن أن يحدث كل منتج بأحجام متعددة محددة مسبقًا استنادًا إلى طول عنصر التكرار ، ولدينا أيضًا فكرة مفادها أنه ليست كل المواقع تعمل بشكل جيد وقد يكون لها ذروة انقسام (تحميل أحادي غير مكتمل) أو مشاكل في التلعثم. في حين أن هذا قد يبدو معقدًا ، فإنه في الواقع يصبح من السهل جدًا تفسير النتائج واستدعاء كل موضع إما فارغ (محذوف متماثل الزيجوت) ، أو متغاير الزيجوت مع قيمتين للحجم ، أو متماثل مع قيمة حجم واحد. (قد يلاحظ البعض منكم أن هناك احتمالًا آخر ، وهو الحذف الدموي. سيظهر هذا أيضًا على أنه ذروة واحدة لحجم الأليل الحالي ، وعلى الرغم من أن منطقة الذروة قد تكون أقل مما هو متوقع بالنسبة لزيجوت متماثل الزيجوت من هذا الحجم ، يمكننا عمومًا لا يكتشف أو يسمي هذا على وجه اليقين ويمكن أن يطلق على هذا بشكل خاطئ اسم متماثل الزيجوت. يتم اختيار Loci بحيث تكون عمليات الحذف نادرة جدًا وبالتالي لا يُتوقع ملاحظة هذه الحالة.)

    لاحظ أنه نظرًا لأننا نبحث عن قمم بأحجام معروفة ومتوقعة - وهذه تختلف بمقدار اثنين على الأقل وأكثر شيوعًا من ثلاثة أو أربعة أو خمسة نيوكليوتيدات - اختلافات طفيفة في الترحيل بسبب على سبيل المثال الاختلاف في القوة الأيونية بين العينات ليس كبيرا. الأحجام كما تم الإبلاغ عنها بواسطة الأداة "محجوبة" لأقرب حجم مطابق ، منتج واضح 161.7 نقطة أساس عندما يكون هناك 161 و 166 أليلات معروفة يمكن تسميتها بشكل مريح 161.

    من خلال تنفيذ هذا التقييم / التجميع على جميع مجموعات العلامات ، يتم إنشاء سلسلة مرتبة من القيم. بينما يعتمد العدد الدقيق على مجموعة العلامات المختارة ، كمثال ، يستخدم التكرار التجاري المشترك لهذه الطريقة 15 موقع VNTR كلاسيكي (ينتج عنه 30 قيمة) وموقع إضافي واحد ، والذي على الرغم من أنه لا يمكن التعامل معه بشكل صارم على أنه VNTR الكلاسيكي واحد و ينتج قيمتين إضافيتين (تشيران إلى ما إذا كانت المادة المصدر ذكرًا أم أنثى) بإجمالي 32 قيمة. هذه المجموعة من القيم هي عينة "بصمة الإصبع".

    التطبيقات

    أين نجد طباعة VNTR المستخدمة في البيئات السريرية (غير الجنائية) اليوم؟ يمكن تطبيقها في أي وقت نرغب في ربط عينتين ، مع اثنين من أكثر الإعدادات شيوعًا:

    • اختبار الأبوة. باستثناء أي تغييرات de novo في رقم النسخ المكرر ، يجب أن يرث الطفل نصف علامات VNTR الخاصة به من كل والد. إن ظهور موضع واحد في النسل يحمل حجمًا غير ممثل في الوالدين المفترضين ، يعني إما حدوث تغيير في حجم de novo (ممكن ، ولكنه نادر) أو على الأرجح ، أن أحد الوالدين (أو كليهما) ليس ' ر كما يعتقد. بالنظر إلى العدد الإجمالي للمواقع التي تم فحصها والتنوع السكاني في كل مكان ، سيكون من النادر جدًا أن لا يظهر شخص ما على الأقل بعض التنوع من أب مفترض غير مرتبط. بالطبع ، من نافلة القول أن كل هذا يمكن تطبيقه على الأمهات أيضًا ، ولكن اختبار الأبوة أكثر شيوعًا من اختبار الأمومة.
    • تتبع العينات ، خاصة في علم التشريح المرضي لكتل ​​الأنسجة. في بعض المعامل ، يتم استخدام هذا كوسيلة لضمان إمكانية تتبع عينات أنسجة FFPE بشكل لا لبس فيه إلى المريض الأصلي.

    فوائد

    أخيرًا ، دعنا نسأل أنفسنا لماذا تظل هذه التكنولوجيا - التي تم تطويرها منذ حوالي 20 عامًا ، في مجال تظهر فيه تقنيات جديدة وتحل محل الأساليب القديمة بشكل متكرر - ذات صلة وتستخدم في الخطوط الأمامية اليوم. الإجابة هي أن عددًا من العوامل تساهم في المتانة والدقة والموثوقية المتأصلة في الطريقة بتكلفة منخفضة وبساطة. بعض هذه السمات تشمل:

    • حساسية منخفضة للتلوث. نظرًا لأن طريقة القراءة (الرحلان الكهربائي الشعري) توفر حجم الذروة في أزواج القاعدة (السمة المقاسة) وارتفاع الذروة أو منطقة الذروة ، فمن الممكن بشكل عام التمييز بوضوح بين إشارات مكون الأغلبية من إشارات الملوثات النزرة. في الواقع ، تتنافس تفاعلات تفاعل البوليميراز المتسلسل (PCR) في الموقع المستهدف من قالب واحد بشكل مباشر مع المواقع المتجانسة من قالب ملوث. نظرًا لأن كفاءات التضخيم متساوية بشكل أساسي ، فإن أحجام الذروة النسبية من قالب (قوالب) الأغلبية والتلوث تعكس بشكل أو بآخر تركيزات البداية النسبية. بمعنى آخر ، إذا كان الملوث هو نسبة انتشار قالب الأغلبية بنسبة 10 في المائة ، فإن قمم VNTR ستكون 10 في المائة من حجم قمم الأغلبية. يسمح هذا كلاهما بالتقييم الجاهز لما إذا كانت العينة تحتوي على قالب واحد أو عدة قوالب ، وفي معظم الحالات حيث يوجد مستوى منخفض من التلوث ، لقراءة إشارة الأغلبية. في حالة احتواء العينة على جينومات متعددة بمستويات متكافئة تقريبًا ، بينما قد لا يكون تخصيص العلامات لتصحيح المصدر ممكنًا ، فمن الواضح على الأقل على الفور وجود جينومات متعددة (عندما تظهر علامات متعددة ثلاثية الصبغيات أو رباعي الصبغيات ، فهي عينة مختلطة ). احتمال وجود عينة غير مكتشفة أو تلوث أو خليط منخفض للغاية.
    • حساسية عالية جدا. نظرًا لاستخدام PCR الكلاسيكي لتضخيم كل موقع من مواقع العلامات ، فإن الحساسيات وصولاً إلى نسخة واحدة ممكنة. لاحظ مع ذلك أنه مع زيادة متطلبات الحساسية ، تقل مقاومة الارتباك عن طريق التلوث حيث من المرجح أن تقترب تركيزات الملوثات من تلك الخاصة بالهدف المرغوب.
    • أداء جيد على الحمض النووي رديء الجودة. نظرًا لأن الأمبليكونات الفردية قصيرة جدًا (عادةً ، 80-250 نقطة أساس أو نحو ذلك) ، فإن الحمض النووي الذي تعرض للتلف والمجزأة غالبًا ما يكون مناسبًا تمامًا لهذه الطريقة ، فكلما كانت الأمبليكون أقصر ، كلما قلت احتمالية كسر الحمض النووي أو الارتباط المتشابك الكيميائي حدث بين مواقع التمهيدي في أي مكان معين.
    • جدوىمن النتائج الجزئية. في حالة المستويات المنخفضة للغاية للقالب و / أو التلف الشديد للحمض النووي ، فمن المحتمل ألا تقدم جميع المواقع نتائج. في حين أن هذا يقلل من قوة تحديد النتيجة ، إلا أنه بمقدار قابل للقياس. فقدان علامة واحدة أو اثنتين فقط من عينة - بصمة DNA الجزئية - يمكن أن توفر مستويات إعلامية (حتى فلكية) من اليقين في نتيجة الارتباط.
    • مجموعات البيانات التي تم إنشاؤها صغيرة ويمكن التلاعب بها بسهولة. في المثال الموضح أعلاه ، بالنسبة لاختبار 16 موضعًا ، تكون النتيجة الكاملة مجرد سلسلة من 32 رقمًا وهي كمية ضئيلة من البيانات حسب المعايير الحسابية ، مما يسمح بسهولة تخزين أعداد هائلة من بصمات الأصابع في قاعدة بيانات واحدة وبحث ومقارنة سريع للغاية الخوارزميات. فيما يتعلق بمعالجة البيانات لقياس درجة الارتباط بين العينات ، فإن الرياضيات راسخة ، وتتطلب القليل من القدرات الحسابية ، وتتعامل بسهولة مع مجموعات البيانات الكبيرة ، ويمكن تصورها بطرق مباشرة مثل أشجار النشوء والتطور.
    • انخفاض متطلبات تكلفة البنية التحتية والفحص. متطلبات الأجهزة الفعلية لهذه الطريقة منخفضة تقريبًا أي مختبر MDx لديه المعدات المطلوبة في متناول اليد. (اعتمادًا على تطبيق معين للطريقة ، من المرجح أن تكون تكاليف الأغلبية مرتبطة بتتبع سلسلة الحراسة من أداء الفحص الفعلي.)
    • السرعة والسهولة في التشغيل الآلي. سهولة الأتمتة تشرح نفسها من حيث سرعة أداء الفحص ، إنها عملية استخراج الحمض النووي ، تفاعل البوليميراز المتسلسل ، الرحلان الكهربائي الشعري ، والتفسير. من الناحية النظرية ، من الممكن تنفيذ جميع الخطوات في يوم عمل واحد بأيدٍ محدودة في الوقت المحدد.

    هذه ليست حتى قائمة شاملة لجميع سمات الأداء الجيد للطريقة ، ولكنها كافية بالفعل لفهم سبب عدم استبدال الطريقة وبصراحة ، من غير المحتمل أن يتم ذلك في أي وقت قريب. إنها طريقة رخيصة وموثوقة ومجربة وحقيقية لربط عينات الحمض النووي بالأفراد (أو ببعضهم البعض) ولتقييم الترابط بين العينات - وهي مفيدة بكل الطرق المذكورة أعلاه.


    البيولوجيا الجزيئية

    10-100 نقطة أساس ، لكن المصطلحات غير محددة بدقة. تسمى هذه الأنواع من التسلسلات أيضًا مناطق VNTR (تكرار عدد متغير جنبًا إلى جنب).

    10 & # 8211 4 لكل كيلو بايت من الحمض النووي. (يُفترض أن يكون تكرار التبادلات لكل موقع فعلي متناسبًا مع طول القمر الصناعي الصغير.)

    10 & # 215 أكبر من معدل إعادة التركيب المتماثل في الانقسام الاختزالي ، أي في أي تسلسل عشوائي للحمض النووي.

    1000 minisatellites can be detected on Southern blot by a probe consisting of the core sequence.

    Both microsatellites and minisatellites are unstable, although for different reasons. Microsatellites undergo intrastrand mispairing, when slippage during replication leads to expansion of the repeat, as shown in Figure 4.28 (Jeffreys et al., 1988). Systems that repair damage to DNA, in particular those that recognize mismatched base pairs, are important in reversing such changes, as shown by a large increase in frequency when repair genes are inactivated (Strand et al., 1993). Because mutations in repair systems are an important contributory factor in the development of cancer, tumor cells often display variations in microsatellite sequences (see 30.29 Defects in repair systems cause mutations to accumulate in tumors).

    Ang paulit-ulit na DNA at Satellite DNA ay dalawang uri ng pag-uulit ng DNA na matatagpuan sa genome. Ang paulit-ulit na DNA ay mga paulit-ulit na paulit-ulit na pagkakasunud-sunod ng DNA habang ang Satellite DNA ay lubos na paulit-ulit, maikling pagkakasunud-sunod ng DNA. Ang pangunahing pagkakaiba sa pagitan ng paulit-ulit at satellite DNA ay ang antas ng pag-uulit.

    1.López-Flores, I., at MA Garrido-Ramos. "Ang Paulit-ulit na Nilalaman ng DNA ng Eukaryotic Genome." Karger Publisher, Hunyo 25, 2012, Magagamit dito.
    2.Garrido-Ramos, Manuel A. "Satellite DNA: Isang Nag-uusbong na Paksa." Mga Gen, MDPI, Setyembre 2017, Magagamit dito.


    Genome Analysis: Microsatellites or SNPs

    Mice and rats are a fundamental component of drug discovery research. Standard outbred stocks and inbred strains of rodents are used extensively for drug safety and pharmacokinetic testing. Our ability to generate specific mutants through transgene insertion or gene knockouts has greatly expanded their utility.

    The NIH has begun the Knock-Out Mouse Project (KOMP), an ambitious program to knock out every gene in the mouse genome. These knockouts are extraordinarily useful for modeling human diseases and elucidating key metabolic and regulatory pathways.

    These valuable animals have been widely disseminated throughout the research community. Unfortunately, there is a widespread perception that the phenotypes displayed by these animals are attributable to the genetic manipulations they carry. هذا ليس الضروري الصحيح. No gene acts alone, but in concert with all the other expressed genes in the organism. Even classic single-gene Mendelian traits, such as sickle cell anemia, display phenotypic variation due to the modifying effects of other genes. Thus the genetic background must be considered in these studies. Rapid, cost-effective, and comprehensive genotyping is essential.

    Mice and rats fall into two broad classes of genetic background. Inbred strains of animals have been generated by repeated sibling mating so that all the animals in an inbred strain are considered genetically identical. Outbred stocks of animals are managed to maximize genetic diversity between individuals. However, all outbred stocks start with a limited population and therefore are not nearly as heterogeneous as populations in the wild. Animals from an outbred stock will share common characteristics.

    The genetic background of animals used in research is of critical importance, as it can have profound effects on the observed phenotype. A phenotype can be profound in one strain and not affect another. In addition, there are cases in which the phenotype of interest was found to be an artifact of a contributing background strain.


    شكل 1

    Genotyping Techniques

    Genetic background analysis is commonly done one of two ways. Microsatellite analysis begins with the identification of regions of non-coding DNA containing short repeats. Each repeat motif is commonly two, three, or four base pairs in size, and the number of repeats is highly variable between different strains. Figure 1 depicts several markers from Elchrom Scientific’s (www.elchcom.com) GenoMouse™ microsatellite panel. Single nucleotide polymorphisms (SNPs) are regions of the mouse genome in which two strains differ by a single base pair. Both methods of genome scanning have advantages and disadvantages depending on the application.

    Microsatellite polymorphisms can arise through replication slippage, unequal crossing over, or mutations extending or interrupting a series of repeats, whereas SNPs arise via point mutations.

    As a result, new microsatellite variations arise more frequently than new SNP variations. However, the absolute number of SNP differences between strains is about a thousand-fold higher than microsatellite differences. Thus, SNP and microsatellite analyses can provide complementary information, and each is better suited for some tasks than others.

    التطبيقات

    In humans, the HapMap project is attempting to delineate SNP differences between different populations with the goal of determining which SNPs are related to disease states. Because of the enormous number of SNPs in the genome, they are grouped into haplotypes. A haplotype is defined as a block of DNA that is inherited as a single unit, in which case one or a few SNPs can serve as markers for a large stretch of DNA. How applicable haplotype groups are throughout the human population is a matter of some debate.

    For forensic identification and paternity testing, microsatellites are used. This enables many fewer loci to be examined, as each locus can exhibit a variety of repeat lengths. The FBI CODIS system requires just 13 microsatellite markers for a standard analysis.

    Options for genome scanning include in-house screening, or core or commercial services such as Elchrom Scientific’s GenoMouse.


    الشكل 2

    مراقبة الجودة

    Misbreedings and animal mix-ups will inevitably occur, even in the best-run animal facilities. Figure 2 illustrates such a situation. Undetected, such mistakes can sabotage experiments, wasting huge amounts of money and time. Good husbandry demands routine genetic monitoring of breeding stocks. Microsatellite analysis is advantageous here, because if a contamination is detected, the sizes of the aberrant microsatellite loci can often provide information on the contaminating strain.

    Speed Congenics

    Because the background strain can play a major role in phenotype, it is important to examine test animals on a uniform genetic background, and ideally on several genetic backgrounds. Backcrossing, the breeding process used to transfer a gene or allele of interest from one strain to another, is a slow and laborious process, taking approximately three years. By analyzing the genomes of backcrossed offspring and selecting the animals with the highest percentage of the desired background strain, it is possible to cut the time required in half.

    Mathematical modeling shows that markers spaced approximately 15 cM apart are effective, and finer mapping does not provide significantly greater speed. GenoMouse uses 96 markers, six on chromosome 1, the largest chromosome, and five markers on all the other autosomes. The sex chromosomes can usually be fixed by breeding rather than selection. The huge datasets generated by SNP analysis are unwieldy for this application.

    Gene Maping and Quantitative Locus Analysis

    Quantitative traits are those traits that show a continuous variation over a range of phenotypes. The phenotype is composed of the combined effects of multiple genes, some with large effects, some with small. To identify the contributing genes, animals from a genetically heterogeneous population are selected for extremes of the trait of interest. They would then be analyzed by genome scanning in order to identify a locus that segregates with the trait.

    Frequently a known candidate gene is present in this region, but sometimes not. The spacing of mouse microsatellite markers, at about one every 100 kb, can be sufficient to identify the gene. SNP markers occur approximately once every kb. It is straightforward to begin a gene hunt with microsatellite markers and then switch to SNPs once the region has been sufficiently defined.

    مقارنات

    One significant advantage of microsatellite analysis is its robustness. The difficult part of the assay is identifying primer sets that amplify well, are well-spaced across all the chromosomes, and show polymorphisms with a size difference sufficient for accurate resolution with the chosen analysis technique. Primer panels may be purchased commercially or developed in-house (a significant research and development undertaking).

    Once the primer sets are in hand, microsatellite analysis can be reassuringly straightforward. Markers are amplified via standard PCR methods and usually sized on gels. Agarose gels are common, although sometimes polyacrylamide gels are chosen for their finer resolution. Elchrom Scientific has a series of hydrogels, which offer clear bands and discrimination of bands with as small a distance as a single base pair. These provide agarose gel electrophoresis with precision equal to to that of polyacrylamide gels.

    Data interpretation of microsatellite assays is straightforward and based on visual identification of the polymorphisms. Unlike microarray data, statistical analysis is not required, and the assay is highly reproducible between different researchers and laboratories.

    The mouse genome differs significantly from the human genome. Some applications that are SNP-based for the human genome may be better approached in the mouse by microsatellite analysis, as mice have two to three times as many microsatellite loci as humans. Mice also have much longer SNP deserts. Thus mouse researchers should evaluate their needs carefully and not rely on human precedent in choosing whether to genotype with SNPs or microsatellites.


    Application of Microsatellite Markers in Conservation Genetics and Fisheries Management: Recent Advances in Population Structure Analysis and Conservation Strategies

    Microsatellites are the most popular and versatile genetic marker with myriads of applications in population genetics, conservation biology, and evolutionary biology. These are the arrays of DNA sequences, consisting of tandemly repeating mono-, di-, tri-, and tetranucleotide units, which are distributed throughout the genomes of most eukaryotic species. Microsatellites are codominant in nature, highly polymorphic, easily typed, and Mendelian inherited, all properties which make them very suitable for the study of population structure and pedigree analysis and capable of detecting differences among closely related species. PCR for microsatellites can be automated for identifying simple sequence repeat polymorphism. Small amount of blood samples or alcohol preserved tissue is adequate for analyzing them. Most of the microsatellites are noncoding, and therefore variations are independent of natural selection. These properties make microsatellites ideal genetic markers for conservation genetics and fisheries management. This review addresses the applications of microsatellite markers in conservation genetics and recent advances in population structure analysis in the context of fisheries management.

    1 المقدمة

    Organisms are incessantly undergoing micro- and macroevolutionary processes both at molecular and organismal levels. In fact, the process of evolution starts at the molecular level, more precisely from a single base of the DNA molecule, and ends up in variations at the organismal level. Genes are the factors, which determine the phenotypic characters of any organism. Thus, the variations that happen to the genes in turn produce individuals, which are different either at the molecular level or at the organismal level. These individuals may form separate groups within the species itself and such groups are the fundamental genetic units of evolution. These intraspecific groups were called as “stocks” and fishery biologists started using these stocks as a basis to manage commercially important marine organisms. Shaklee et al. [1] defined a stock as “a panmictic population of related individuals within a single species that is genetically distinct from other such populations.” Therefore, in any management regime, identification of discrete stocks becomes a critical element [2, 3].

    Genetic variation in populations became a subject of scientific enquiry in the late nineteenth century prior even to the rediscovery of Mendel’s paper in 1900. Genetic variation, in the form of multiple alleles of many genes, exists in most natural populations. In most sexually reproducing populations, no two organisms (barring identical twins or other multiple identical births) can be expected to have the same genotype for all genes [4]. In 1990s, genetic markers became more popularized for the identification of stock structure and genetic variation in a population. The detection of genetic variation among individuals is a requirement in all applications of genetic markers in fisheries biology. A genetically inherited variant in which the genotype can be inferred from the phenotype during genetic screening is known as a genetic marker. The most common use of genetic markers in fisheries biology is to determine if samples from culture facilities or natural populations are genetically differentiated from each other. They are also used to identify different species in the event of taxonomic disputes and to detect genetic introgression in a species. The detection of genetic differentiation would imply that the source groups comprise different stocks [5] and should be treated as separate management units or stocks [6]. A common objective of molecular genetic analyses is to find diagnostic differences among presumed stocks in either nuclear allelic types or mtDNA haplotypes [7]. Polymorphic DNA markers can provide fisheries researchers with new insights into the behavior, ecology and genetic structure of fish populations, levels of inbreeding, disassortative mating success of alternative reproductive strategies and life histories, and the intensity of natural and sexual selection [8]. Microsatellites are one of the best suitable genetic markers for analyzing pedigree, population structure, genome variation, evolutionary process, and fingerprinting purposes.

    Genetic markers are basically two types—protein and DNA (molecular). In the beginning of 1960s, the proteins such as haemoglobin and transferrin were involved in all studies. In protein markers, allozyme markers are very popular and most of the genetic variation studies have been conducted based on this marker [9–14]. Molecular markers can be categorized into two classes, nuclear DNA and mitochondrial DNA (mtDNA) markers, based on their transmission and evolutionary dynamics [15]. Nuclear DNA markers such as random amplified polymorphic DNA (RAPDs), amplified fragment length polymorphisms (AFLPs), variable number of tandem repeats loci (VNTRs: minisatellites, microsatellites), and single nucleotide polymorphisms (SNPs) are biparently inherited. Mitochondrial DNA markers are maternally inherited, exhibit high rates of mutation, and are nonrecombining such that they have one-quarter the genetic effective population size (Ne) of nuclear markers [8]. Using restriction enzymes mtDNA sequence can be cut at specific sites to generate restriction fragment length polymorphisms (RFLPs) or sequence analysis of different genes of mtDNA can be used to detect phylogenetic relationships, undertake pedigree analysis, and assess population differentiation in many species.

    Detection of polymorphisms at the nucleotide sequence level represents a new area for genetic studies, especially as technologies become available, which allow routine application with relative ease and low cost. From the 1990s an increasing number of studies have been published making use of random parts of a genome. With the advent of thermocyclers, the amplification of small fragment of DNA through polymerase chain reaction (PCR) gained popularity. The PCR technique was discovered in 1985 and the development of DNA amplification using the PCR technique has opened the possibility of examining genetic changes in fish populations over the past 100 years or more using archive materials such as scales [8]. The advent of PCR coupled with automated DNA sequencers made feasible major technological innovations such as minisatellite variant repeat mapping [16] and assessment of the variations at microsatellite loci [17]. The PCR based techniques have the added attraction of requiring only extremely small amounts of DNA that has led to wide usage of this technique in aquaculture and fisheries. In this review, we discuss the application of the most prevalent genetic marker, microsatellites, in population genetic structure and its usefulness in conservation of fish fauna.

    2. Microsatellites Markers

    Recently, attention has turned to another type of genetic variation that of differences in the number of repeated copies of a segment of DNA. These sequences can be classified based on decreasing sizes into satellites, minisatellites, and microsatellites [13]. Satellites consist of units of several thousand base pairs, repeated thousands or millions of times. Minisatellites consist of DNA sequences of some 9–100 bp in length that are repeated from 2 to several 100 times at a locus. Minisatellites discovered in human insulin gene loci with repeat unit lengths between 10 and 64 bp were also referred to as “variable number of tandem repeats” (VNTRs) DNA [18]. Microsatellites have a unique length of 1–6 bp repeated up to about 100 times at each locus [19]. They are also called as “simple sequence repeat” (SSR) by Tautz [13] or “short tandem repeat” (STR) DNA by Edwards et al. [20]. Jeffreys et al. [21] and Weber [22] opined that length variations in tandemly arrayed repetitive DNA in mini- and microsatellites are usually due to an increase or decrease in repeat unit copy numbers. Differences in repeat numbers represent the base for most DNA profiling techniques used today. Later, only microsatellites became very common in population genetics studies.

    Microsatellites are short tandemly arrayed di-, tri-, or tetranucleotide repeat sequences with repeat size of 1–6 bp repeated several times flanked by regions of nonrepetitive unique DNA sequences [13]. Polymorphism at microsatellite loci was first demonstrated by Tautz [13] and Weber and May [17]. Alleles at microsatellite loci can be amplified by the polymerase chain reaction [23] from small samples of genomic DNA and the alleles separated and accurately sized on a polyacrylamide gel as one or two bands and they are used for quantifying genetic variations within and between populations of species [24]. The very high levels of variability associated with microsatellites, the speed of processing, and the potential to isolate large number of loci provide a marker system capable of detecting differences among closely related populations. Microsatellites that have been largely utilized for population studies are single locus ones in which both the alleles in a heterozygote show codominant expression [25]. Individual alleles at a locus differ in the number of tandem repeats and as such can be accurately differentiated on the basis of electrophoresis (usually PAGE) according to their size. Different alleles at a locus are characterized by different number of repeat units. They give the same kind of information as allozymes: distinguishable loci with codominant alleles, but they are generally neutral and more variable than allozymes [26]. Like allozymes, microsatellites alleles are inherited in a Mendelian fashion [27]. Moreover, the alleles can be scored consistently and compared unambiguously, even across different gels. An additional advantage is that they allow the use of minute or degraded DNA [26].

    Generally, microsatellite loci are abundant and distributed throughout the eukaryotic genome [28] and each locus is characterized by known DNA sequence. These sequences consist of both unique DNA (which defines the locus) and repetitive DNA motifs (which may be shared among loci). The repetitive elements consist of tandem reiterations of simple sequence repeats (SSRs) and are typically composed of two to four nucleotides such as (AC)ن or (GATA)ن أين ن lies between 5 and 50 [29]. Within vertebrates, the dinucleotide repeats -GT and CA- are believed to be the most common microsatellites [30]. Study of single locus microsatellites requires specific primers flanking the repeat units, whose sequences can be derived from (i) genomic DNA libraries or (ii) from available sequences in the gene banks (Figures 1 and 2). These two methods are generally used for the development of microsatellite markers. The second method is extensively described in the coming section. In a review, Zane et al. [31] showed several methods of development of microsatellite markers.


    SSRs in Coding Regions

    Nonrandom Distribution

    Numerous SSRs exist in ORFs of higher eukaryotes including ذبابة الفاكهة, أنواع معينة انيقة, mammals, humans, plants, and yeast ( Tóth, Gáspári, and Jurka 2000 Katti, Ranjekar, and Gupta 2001 Kantety et al. 2002 Morgante, Hanafey, and Powell 2002). SSR occurrence in coding regions seems to be limited by non-perturbation of the reading frame. This has been proved by the following facts: (1) in a human cDNA database, more than 92% of the predicted SSR polymorphisms within coding sequences have repeat-unit sizes that are a multiple of three ( Wren et al. 2000) (2) in many species, exons (unlike other genomic regions) contain rare dinucleotide and tetranucleotide SSRs, but have many more triplet and hexanucleotide SSRs than other repeats ( Field and Wills 1996 Edwards et al. 1998 Metzgar, Bytof, and Wills 2000 Wren et al. 2000 Young, Sloan, and van Riper 2000 Cordeiro et al. 2001 Morgante, Hanafey, and Powell 2002). Triplet repeats show approximately twofold greater frequency in exonic regions than in intronic and intergenic regions in all human chromosomes except the Y chromosome ( Subramanian, Mishra, and Singh 2003). In prokaryotic genes related to adaptation or responses to stress of الإشريكية القولونية K12, mononucleotide and trinucleotide SSRs are significantly overrepresented, whereas dinucleotide and tetranucleotide repeats are underrepresented ( Rocha, Matic, and Taddei 2002). Such dominance of triplets over other repeats in coding regions may be explained on the basis of the suppression of non-trimeric SSRs in coding regions, possibly caused by frameshift mutations ( Metzgar, Bytof, and Wills 2000).

    The presence of SSRs in coding regions shows bias to some specific nucleotide composition. Thus, A/T repeats are more frequent (11.8% of 45,425 coding sequences: CDSs) than G/C repeats (0.7%) in human coding sequences ( Olivero et al. 2003). Exons and ESTs show higher frequency for GA/CT repeat than for AT repeat in نبات الأرابيدوبسيس thaliana ( Morgante, Hanafey, and Powell 2002) and cereals ( Kantety et al. 2002 Morgante, Hanafey, and Powell 2002). The AC/GT repeats in plants were more rare than in animal genomes ( Tóth, Gáspári, and Jurka 2000 Morgante, Hanafey, and Powell 2002). This pattern may be related to high frequencies of certain amino acids in plants than in animals ( Tóth, Gáspári, and Jurka 2000).

    Triplet repeats in exons can be grouped into 10 motif subclasses ( table 1), each representing six overlapping and complementary unit patterns ( Jurka and Pethiyagoda 1995). In the animal kingdom, AGC was the most common motif (40.9%–60.9%). In plants, the most frequent triplet motif is AAG subclass (28.3%–42.1%) in A. thaliana, grape, and endophytes ( table 1). In cereal species, however, the most common triplet is CCG in all the species, ranging from 32% in wheat to 49% in sorghum ( Varshney et al. 2002 Thiel et al. 2003), to 39.3% in sugarcane ( Cordeiro et al. 2001). The abundance of CCG repeats is a specific feature of monocot genomes, and it may be due to their increased GC content ( Morgante, Hanafey, and Powell 2002). The AAT motifs were the least common (<1%) in monocot species ( Cordeiro et al. 2001 Varshney et al. 2002 Thiel et al. 2003) and in other species listed in table 1. This may be explained by the fact that TAA-based variants code for stop codons that have a direct effect on protein synthesis in eukaryotes.

    Frequencies of Different Codon Repeats Vary Considerably Depending on the Type of Encoded Amino Acid

    In plants, the most common codon repeats are codons for Lys in أرابيدوبسيس and codons for Arg in sugarcane ( table 2). في ذبابة الفاكهة, C. ايليجانس, and yeast, the most common codon repeats are CAA and CAG encoding Gln in complete genome coding DNA sequences ( Katti, Ranjekar, and Gupta 2001). It is interesting that those expansions of codon repeat corresponding to small/hydrophilic amino acids are more tolerated (with ≥14 repeat times) than are hydrophobic amino acids (with shorter repeat times) ( Katti, Ranjekar, and Gupta 2001). At the DNA level, the AGC, GCA, CAG, CTG, TGC, and GCT repeats (representing the same repeating DNA duplex) are quite similar, and their frequencies can be expected to be comparable. In fact, however, ذبابة الفاكهة coding regions display a strong bias to CAG (Gln: 77.5% of a total of 1,909 of this repeat group), and very rare for CTG (leucine: 0.6%) and TGC (cysteine: 0.2%) ( Katti, Ranjekar, and Gupta 2001). In yeast proteins, the most abundant amino acid repeats are codons of Gln, Asn, Asp, Glu, and Ser ( Richard and Dujon 1997 Alba, Santibáñez-Koref, and Hancock 1999). Different amino acid repeats are concentrated in different classes of proteins. Acidic and polar amino acid repeats are significantly associated with transcription factors and protein kinases, whereas Ser repeats are significantly associated with membrane transporter proteins ( Alba, Santibáñez-Koref, and Hancock 1999). Interestingly, in yeast, the longest triplet repeats (≥ 75 bp) are often found in nuclear-protein genes ( Richard and Dujon, 1997). Strong bias in favor of certain limited sets of amino acids in different proteins or cell locations showed that triplet repeats in ORFs were nonrandom with respect to the ORFs and DNA strands ( Richard and Dujon 1997). Similarly, in humans and mice, repeat-containing genes were enriched in certain amino acids such as Pro, Gln, His, and Ser (for codons, see table 2 Hancock, Worthey, and Santibáñez-Koref 2001). Likewise, CGG, CCG, CAG, and GAA repeats coding for (Ala)ن, (Gly)ن, (Pro)ن, (Gln)ن, and (Lys)ن are abundant in primate genes ( Borštnik and Pumpernik 2002). The above evidence may suggest that functional selection acts on amino acid reiteration in the encoded proteins ( Alba, Santibáñez-Koref, and Hancock 1999 Katti, Ranjekar, and Gupta 2001), but this selection did not reflect underlying biases in base composition.

    The abundance of CAG repeats in yeast coding regions ( Alba, Santibáñez-Koref, and Hancock 1999 Katti, Ranjekar, and Gupta 2001) parallels its abundance in mammalian exons ( Stallings 1994). However, AAT repeats, also very abundant in yeast coding regions, are rare in the exons of mammals, and GGC repeats, relatively abundant in mammalian exons ( Stallings 1994), are uncommon in yeast genes. This may be because Asn repeats (AAT) are not tolerated in mammals, and that the same is true for Gly repeats (GGC) in yeast. Asn repeats appear to be rare in vertebrates but more common in invertebrate, yeast, and plant proteins ( Stallings 1994). Alternatively, these differences could be due to differences in the slippage process between the groups, or they may reflect the low GC content of the yeast genome ( Richard and Dujon 1997).

    Phenotypic Effect of SSRs in Coding Regions

    Simple sequence repeat variation within genes should be very critical for normal gene activity because encoding SSR expansion or contraction directly affects the corresponding gene products and even causes phenotypic changes. In eukaryotes, SSR effects in coding regions on phenotypes have been extensively studied only in human diseases, revealing abundant evidence on human neuronal disorders and cancers.

    Exon CAG Repeat Expansion Produces Toxic Mutant Proteins Causing Human Diseases

    Human repeat expansion diseases are predominantly neurological and are caused by instability and expansion of triplet motifs within or near genes (reviewed in Cummings and Zoghbi 2000 Masino and Pastore 2002). The largest class of these diseases results from the expansion of coding CAG repeats that are translated into extended (Gln)ن tracts within the corresponding proteins. These dominantly inherited diseases include Huntington's disease (HD), dentatorubro-pallidoluysian atrophy (DRPLA), spinobulbar muscular atrophy (SBMA), and spinocerebellar ataxia (SCA1, SCA2, SCA3, SCA6, and SCA7 table 3). All eight disorders are progressive, typically striking in midlife, and causing increased neuronal dysfunction and eventually neuronal loss 10–20 years after the onset of symptoms. Several other features characterize this group of diseases: the greater the number of CAG repeats on expanded alleles, the earlier the age of onset and the more severe the disease. The repeats show both somatic and germline instability (see review: Zoghbi and Orr 2000 Lima et al. 2001). Successive generations of affected families experience anticipation, or earlier age of onset, and more rapid disease progression as a result of intergenerational repeat instability that is particularly marked in paternal transmissions. CAG contraction within androgen receptor gene was involved in cancer or other diseases ( table 3).

    How could the expanded CAG repeats cause these diseases? There is strong evidence demonstrating that the expanded (Gln)ن stretch confers either a gain- or change-of-function onto the corresponding proteins (see reviews: Galvão et al. 2001 Ranum and Day 2002). In most cases, a toxic gain of function of the mutant protein was demonstrated. For instance, both cell culture and animal studies clearly demonstrate that a long (Gln)ن tract is toxic to neurons and peripheral cells alike ( Galvão et al. 2001). Additional peptide sequences from expanded CAG repeats must contribute to the late onset of these diseases and selective neuronal vulnerability. This neuronal selectivity disappears in the earliest juvenile-onset cases, when the (Gln)ن tract becomes disproportionately large relative to the rest of the protein there may be a threshold for Gln repeat length beyond which it becomes the predominant toxic moiety ( Zoghbi and Orr 2000). It is also possible that RNAs containing CAG expanded repeats may either interfere with processing of the primary transcript, resulting in a deficit of the corresponding protein, or interact with RNA-binding proteins, altering their normal activity (see review: Galvão et al. 2001). Recent experiments suggest that, in addition to the ubiquitin/proteasome pathway, mutant proteins with expanded (Gln)ن stretches are involved in the lysosomal pathway for protein degradation, and that this processing mechanism may serve as a target for new therapeutic approaches to CAG repeat diseases ( Yamada, Tsuji, and Takahashi 2002).

    Monomer SSR Variation in Coding Regions Inactivates MMR Genes via Frameshift, but Leads Also to Other Truncated Proteins in Tumor Cells

    Microsatellite instability (MSI) occurs in about 90% of hereditary nonpolyposis colorectal cancers (HNPCC) as well as in about 15% of sporadic tumors of the colon ( Mark Redston 2001), in numbers of gastric ( Yamada et al. 2002أ), lung ( Zienoddiny et al. 1999), and endometrial cancers ( Vassileva et al. 2002). It has been proved that many MSI tumors are caused by mutational inactivation of the different MMR genes listed in table 3. The mutational inactivation was caused mainly by a frameshift occurring within the (A)ن tracts located in exons of both major and minor MMR genes (for review, see Duval and Hamelin 2002), except the methylation of the hMLH1 promoter ( Yanagisawa et al. 2000).

    Likewise, a number of SSR-containing genes (listed in table 3) are frequently affected by the MSI in tumor cells. Like the MMR genes, these genes also contain (A)ن tracts in coding regions, which can lead to frameshift mutation in MMR-defective cells ( Duval and Hamelin 2002). The proteins encoded by these genes display tumor-suppressive functions and, thus, represent major targets of mutator pathway-associated carcinogenesis ( Schwartz et al. 1999). Most MSI–High-frequency (MSI-H) tumors had acquired frameshift mutations in more than one gene among hMSH3, hMSH6, BAX, IGFIIR, TGFbetaIIR, E2F4, and BRCA2 ( Johannsdottir et al. 2000).

    The human hTCF4 gene interacts functionally with β-catenin in the Wnt signaling pathway. Alternative use of different reading frames in the exon 17 of hTCF-4 generates different protein isoforms with agonist or antagonist transactivating activities ( Duval et al. 2000). A 1-bp deletion in an (A)9 repeat within exon 17, as well as other frameshift mutations, results in decreasing the proportion of the long COOH-terminal hTCF-4 isoform, which contains two binding domains for c-terminal binding protein, a protein implicated in the repression of the TCF family transcriptional activity. Thus, loss of the TCF-4 capacity to interact with COOH-terminal binding protein could have an important effect in colorectal carcinogenesis by modifying Wnt-signaling ( Duval et al. 2000).

    SSR Variation in Coding Regions Affects Gene Expression and Pathogenesis in Prokaryotes

    The presence of SSRs in prokaryotes is rare, but most that do occur are related to pathogenic organisms their variation in repeat numbers can also cause phenotypic changes (reviewed in van Belkum et al. 1998). These SSR motifs were reminiscent of the presence of repetitive elements consisting of uptake signal sequences, intergenic dyad sequences, and multiple tetranucleotide iteration ( Karlin, Mrazek, and Campbell 1997). المستدمية النزلية (أهلا), an obligate upper respiratory tract commensal/pathogen, uses phase variation (PV) to adapt to host environment changes. Switching occurs by slippage of SSR repeats within genes coding for virulence molecules ( Hood et al. 1996). Most such SSRs in أهلا are tetranucleotide repeats, which are listed in table 3. The high prevalence of tetranucleotides mediating PV is an exceptional feature of the أهلا الجينوم. For instance, Weiser, Love, and Moxon (1989) found that different patterns of lipopolysaccharide expression (LPS: LPS phase variation functions as an adaptation mechanism enabling bacteria to escape the immune system attack and to translocate across various physical barriers: van Putten 1993) and the molecular switch leading to this phenotypic variability appeared to be dependent on the translational capacity of the gene lic1 mRNA, which is caused by variable numbers of a CAAT motif within this gene. Variation in the overall number of this CAAT unit moves one of the three ATG codons in or out of the protein synthesis reading frame, and it then directly affects protein synthesis and the primary amino acid sequence. More examples are listed in table 3.

    Variation in the opacity surface proteins (Opa) occurs by recA-independent rearrangements in the coding repeat sequence. In this region, shifting of the translational reading frame occurs because of changes in the repetitive DNA track ( Murphy et al. 1989). These changes occur independently in any of the opa genes, which account for the production of several different Opa proteins simultaneously. The relationship between the superficial Opa protein composition of a bacterial isolate with invasiveness into the human epithelium has been demonstrated experimentally ( Makino, van Putten, and Meyer 1991). A variable number of CTCTT motifs in the opa leader peptide moves the reading of the gene in or out of the frame. This sequence is peculiar because a triple-helix conformation is likely to occur, and the CTCTT repeat region appears to be hypersensitive to single-strand-specific nuclease. The number of repeats varies continuously at low frequency in vivo. Once environmental selection influences survival of one of the “minority SSR types,” this type will “translate” its selective advantage into overgrowth of the existing population ( Makino, van Putten, and Meyer 1991).

    In general, the examples mentioned in this section and in table 3 emphasize the importance of SSR elements in many aspects of تكيفية behavior in bacteria. SSR variations enable bacteria to respond to diverse environmental factors, and many of them are clearly related to bacterial pathogenesis and virulence. The contingent genes containing SSRs show high mutation rates, allowing the bacteria to act swiftly on deleterious environmental conditions ( Moxon et al. 1994). Some of the SSRs seem to play an essential role in controlling surface exposition of active protein domains and antigenic variation.


    What are microsatellite markers?

    انقر لقراءة الإجابة المتعمقة. In this way, what are microsatellite markers used for?

    Microsatellites are widely يستعمل ل DNA profiling, also known as "genetic fingerprinting", of crime stains (in forensics) and of tissues (in transplant patients). They are also widely مستعمل في kinship analysis (most commonly in paternity testing).

    Secondly, what are Minisatellites and microsatellites? أ minisatellite is a tract of repetitive DNA in which certain DNA motifs (ranging in length from 10&ndash60 base pairs) are typically repeated 5-50 times. Confusingly, minisatellites are often referred to as VNTRs, and السواتل الدقيقة are often referred to as short tandem repeats (STRs) or simple sequence repeats (SSRs).

    In this manner, what are two features of microsatellites?

    Particular characteristics of microsatellites, such as their presence in the genomes of all living organisms, high level of allelic variation, co-dominant mode of inheritance and potential for automated analysis make them an excellent tool for a number of approaches like genotyping, mapping and positional cloning of

    Why microsatellites are still a marker of choice in population genetic studies?

    Microsatellite markers are useful for population genetic studies because many are considered highly polymorphic. These different allele frequencies increase the potential to observe وراثي الاختلافات بين السكان if they exist.


    شاهد الفيديو: البث الفضائي والاتصالات عبر الاقمار الصناعية المحاضرة 1 satellite communication system (قد 2022).


تعليقات:



اكتب رسالة